Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024012 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA024012
Gene: COMMD2_0
MFE: -24.896
ENS: 0.838
Length: 80.
Predicted Ligands:
SAM - 9/20
homocysteine - 3/20
zmp-ztp - 2/20
 RS: URS0000AB3460_278197
MFE: -10.438
Ligand: SAM
Species: Pediococcus pentosaceus ATCC 25745 SMK box translational riboswitch (SAM-III)
 RS: URS0000C2EAFE_1263010
MFE: -19.633
Ligand: zmp-ztp
Species: Firmicutes bacterium CAG:227 ZMP/ZTP riboswitch
 RS: URS0000AB6B41_288000
MFE: -23.350
Ligand: SAM
Species: Bradyrhizobium sp. BTAi1 SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024012 URS0000AB3460_278197 URS0000C2EAFE_1263010 URS0000AB6B41_288000
Length 80. 81. 79. 80.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.838 - - -
MFE -24.896 -10.438 -19.633 -23.350
Ligands - SAM zmp-ztp SAM
Gene COMMD2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7.002 4.001
Length SE - 1. 1. 0.
Lev Distance - 20. 19. 22.
UBS 5. 5. 5. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 4. 2.
ILR 2. 1. 1. 1.
H 1. 1. 1. 2.
BL 1. 2. 0. 2.
BR 2. 1. 1. 2.
UN 0.075 0.037 0.114 0.050

Sequences

Field Description
UTR seq + 25 cggaaguggcgaaggcggggucggcgcugccgggugaaaucguaggacagugaagATGCTGCTGGAATTGTCCGAGGAGC
UTR dot + 25 ((((………(((((.(((..(((((((………….)).)))))..))).)))))…….))))……
RS 1 seq GUAAGUUACUAGUGUUCCCGAUAGGAUUAGUUAUCCAAAAGAUCCUUGUAACCGAAAUUAAAUUUAGGGGGAAUUUACAUG
RS 1 dot ((((………((((((..((((.((((((.((………………)))))))).))))..))))))))))…
RS 2 seq AAUUGCUUAUAUGACUGACGGAAGUGGAAUCAACCACAGGGAGUAUAAGCCGUUGAAGCCGACCGUCUGGGCAUUGGAU
RS 2 dot …((((((…….(((((…(((..(((((….((………)))))))..))).)))))))))))……
RS 3 seq CACUUAUCCCGUGGUGAUUUGAGCCGGCCGGCUUGCAGCCACGUUAAAUAAGUCGCUAAACAGGCCGGGGACGAAUGUGA
RS 3 dot ((((……..))))(((((..((..((((((((.(((.((………)).)))…)))))))))).)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table