Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024094 Similarity: 0.942 Similarity: 0.942 Similarity: 0.935
UTR: 5HSAA024094
Gene: COPB1
MFE: -58.766
ENS: 0.834
Length: 205.
Predicted Ligands:
cobalamin - 9/20
TPP - 6/20
zmp-ztp - 1/20
 RS: URS0000BF8A8A_1380566
MFE: -63.802
Ligand: TPP
Species: Pochonia chlamydosporia 170 TPP riboswitch (THI element)
 RS: URS0002325E88_1891224
MFE: -33.776
Ligand: cobalamin
Species: Acinetobacter celticus Cobalamin riboswitch
 RS: URS000231C597_742767
MFE: -38.933
Ligand: cobalamin
Species: Dysgonomonas mossii DSM 22836 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024094 URS0000BF8A8A_1380566 URS0002325E88_1891224 URS000231C597_742767
Length 205. 205. 205. 203.
Similarity - 0.942 0.942 0.935
Ensemble Norm 0.834 - - -
MFE -58.766 -63.802 -33.776 -38.933
Ligands - TPP cobalamin cobalamin
Gene COPB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.009 13.007 19.
Length SE - 0. 0. 4.
Lev Distance - 73. 71. 70.
UBS 13. 15. 14. 16.
BS 0. 0. 0. 0.
ILL 3. 3. 6. 4.
ILR 5. 5. 4. 7.
H 1. 3. 1. 1.
BL 4. 5. 5. 6.
BR 5. 5. 6. 4.
UN 0.029 0.122 0.112 0.044

Sequences

Field Description
UTR seq + 25 aaaauacgugguuucauugcucugcggccuaaucaaacccuggacaagagaagaggaagaaaauaggauauacuugcagcgcgcaagcgcugcacaaagaaagcauguccucucugagucgccauuuucuggcauccuuaaaucuugugucaaggauugguuauaauauaaccagaaaccATGACGGCGGCTGAGAACGTATGCT
UTR dot + 25 …((((((..(((((…….((.((((((((((.((.(((((((((…(((((((((((((((((((.((((((((((….))))))))…….)).)))))))…………)))))))….)))))…)))))).))).)).)))))))………………….))).)))))))))))))…
RS 1 seq AAGAAUGCAACCGGGUGUUCAAUCUUAUUCCUGCCGUGUGAGGCUCUUGACGCUUGACACACAUCCAUCUUGCUUUUAAUGGUCAAACCUGGCAAUGCGUGUCUACCCAGCGUCUCGAGUCCGCACGGCGAGAUGAUUGAUCUGAGAAAUACCGGUGAACUUGAUCUGGAUAAUACCAGCGAAAGGAUUUGCUUCUUGAAGACUC
RS 1 dot ………((((.((((((((((….((.(((((((((.(((((..((((((.(((((.((((((..(((((……)).)))…)))..))).)))))…..))))))..)))))))))))))).)).))))))……..))))))))………((((……))))((((((……))).)))…….
RS 2 seq UGCGCGCAAAAUGCAACAAGUCCAAGCACUCGCUUUAGGGAAGUCGGUUAAAAUCCAACACUGCCCCCGCAACGGUAAAAUGAAAAGCUUAUCUUUCAUAAAUCAUAGAGAUUUACAUCACUGCAUAGCCAUGUGGGAAGGUGGAUAAGUAGCUUUAUUAUAAGCACAUUUAAGUCCGGAAACCUGCUUGUUGCCCCUCAACUCA
RS 2 dot …………(((((((((((..((….(((((((.(((((.(.(((…(((.((.((…((((((..(((…………..((((((……….))))))……………))).)))))).)))))))))).).))))).))).))))……..))..))……)))))))))………..
RS 3 seq AACUUUGUCACAGGUUUUGGUGUCAUUUACUAUAUCCAUAGAAAAUGAUGAAAAGGGAAUCAGGUGAAAGUCCUGGACAGACCCGCUGCUGUAAGCUCCUCCAAAGACUUUGAACAAUACUCUAUCCACUGUUCUUACACUGAAUGGGAAGGAUGCUCAAAGAUAAAGUAAGUCAGAAGACCUGCCAGAACCGUGUAAUUUGA
RS 3 dot ….(((.(((.(((((((((((((((((((.(((((((……(((.(((.(((((….((((((((((.((((..((…(((……))))).))))..))))))……))))…))).)).))))))……))))……………))).)))))))…..)))..)))))))))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table