Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024098 Similarity: 0.948 Similarity: 0.940 Similarity: 0.935
UTR: 5HSAA024098
Gene: COPB1_0
MFE: -69.
ENS: 0.782
Length: 210.
Predicted Ligands:
cobalamin - 9/20
FMN - 6/20
glucosamine - 4/20
 RS: URS0000C7EAD8_1743142
MFE: -76.887
Ligand: FMN
Species: Bacillus sp. FJAT-26390 FMN riboswitch (RFN element)
 RS: URS0000D87E0D_1920422
MFE: -77.087
Ligand: FMN
Species: Paenibacillus sp. FSL H8-0548 FMN riboswitch (RFN element)
 RS: URS0000D7CA8A_1981174
MFE: -72.585
Ligand: FMN
Species: Pseudomonas sp. M30-35 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024098 URS0000C7EAD8_1743142 URS0000D87E0D_1920422 URS0000D7CA8A_1981174
Length 210. 209. 210. 210.
Similarity - 0.948 0.940 0.935
Ensemble Norm 0.782 - - -
MFE -69. -76.887 -77.087 -72.585
Ligands - FMN FMN FMN
Gene COPB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.004 21.004 7.007
Length SE - 1. 0. 0.
Lev Distance - 69. 68. 84.
UBS 14. 14. 14. 14.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 3.
ILR 2. 2. 4. 2.
H 5. 5. 5. 6.
BL 5. 5. 5. 3.
BR 6. 6. 2. 5.
UN 0.224 0.163 0.162 0.138

Sequences

Field Description
UTR seq + 25 ccacccccuuccacgucagccaaggacucuggagccgccgccgccgcugcugcgguucauagccggaguagacggagccgcaguagacggauccgcggcugcaccaaaccacugccccucggagccugauuuucuggcauccuuaaaucuugugucaaggauugguuauaauauaaccagaaaccATGACGGCGGCTGAGAACGTATGCT
UTR dot + 25 …………..(((…….)))..(((.((.(((((..((((((((((((((…..(((…….)))))))))))))).)))….))))).)).)))…………..((((((.((…)).))).)))………..((((.((.((((((((…))))))))…)).)))).(((……..)))…..
RS 1 seq GCUUUCCUUCGGGGUCAGGUGAAAUUCCUAACCGGCGGUGAUCGGCAGGUGCAGGGGGAUCGGAUAACCGAACUUCUGUGCUUGUCGUCAGUCCGUGACCCGGUCUAAGAUGCUUUUACUCGGAGUUAUCCGAAUAAAAUGCGGAUUGGAACGGUGGACCUGGUGUAAAUCCGGGACCGACAGUACAGUCUGGAUGGGAGAAGGGGAUG
RS 1 dot …………(((.(((…….))).))).(((((((.(((((((((((((((..((((….)))).))))))))))))))))))..))))…(((.(((((..((((((((.(((((….))))).))))).)))..))))).)))(((.(((((…….))))).))).(((……)))……………..
RS 2 seq AGCUUCCUUCGGGGUCAGGUGAAAUUCCUAACCGGCGGUGAUCGGGACGGCACAGAUAGAUCGGACAACCGAAAUUCUGUGCCUCUCGUCAGUCCGUGACCCGGUUUAAUGAGCUUUCUUCUCGAUUAAUUUCGAGAGAAAGUGAAUUGAAACGGUGGACCUGGUGUAAAUCCGGGACCGACAGUAAAGUCUGGAUGGGAGAAGGGGAUG
RS 2 dot …………(((.(((…….))).))).(((((((.(((((.((((((((….((((….))))…))))))))))))))))..))))…(((..(((((..((((((.((((((……))))))))))))..)))))..)))(((.(((((…….))))).))).(((……)))……………..
RS 3 seq CAACGUUCUCAGGGCGGGGUGUAAUUCCCCACCGGCGGUAAUGAUGCGCAAUGCGUCUAGCCCGCGAGCGCUUGGUGCCCUUGUUAGGUCAAUGGGUGACAAGGUCAGCAGACCCGGUGUGAUUCCGGGGCCGACGGUUACAGGCUUUUGCAAACACUGUUUAUGCGGUGUUUUGCAGGGUUCUACAGUCCGGAUAAAGAGAGAGCGGGU
RS 3 dot …………((.((((…….)))).)).((((….(((((…..)))))….))))…..((((..(((((((……))).))))..))))(((.((…(((((…….))))))).)))……(((.(((((((((((((((….))))))))).)))))).)))….((((………….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table