Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024280 Similarity: 0.962 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA024280
Gene: COPS7B
MFE: -38.486
ENS: 0.862
Length: 128.
Predicted Ligands:
TPP - 7/20
SAM - 4/20
Mn2+ - 3/20
 RS: URS0000DA14B8_1470176
MFE: -53.932
Ligand: TPP
Species: Actinoalloteichus hoggarensis TPP riboswitch (THI element)
 RS: URS0000DA0B07_683354
MFE: -58.341
Ligand: Mn2+
Species: Candidimonas nitroreducens yybP-ykoY manganese riboswitch
 RS: URS0000C78DED_1206458
MFE: -48.336
Ligand: glycine
Species: Novosphingobium sp. MBES04 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024280 URS0000DA14B8_1470176 URS0000DA0B07_683354 URS0000C78DED_1206458
Length 128. 128. 127. 128.
Similarity - 0.962 0.961 0.961
Ensemble Norm 0.862 - - -
MFE -38.486 -53.932 -58.341 -48.336
Ligands - TPP Mn2+ glycine
Gene COPS7B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.007 25.006 8.002
Length SE - 0. 1. 0.
Lev Distance - 49. 40. 49.
UBS 9. 11. 7. 8.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 0. 1. 1. 0.
H 5. 5. 4. 4.
BL 4. 4. 1. 2.
BR 4. 3. 1. 3.
UN 0.164 0.078 0.087 0.125

Sequences

Field Description
UTR seq + 25 ggggugaucauggacgcuugacaaccugcgggcaggcgccgggaggccgagccagcgacuaagaggaccgagagguggcguggacagauuucaaggccagagaATGGCAGGGGAACAGAAACCCTCAA
UTR dot + 25 .(((((……..)))))…..(((.(.(((….))).).)))(((.((((.(……………..).)))).)))…………((((…..))))((((………))))…
RS 1 seq ACUCCACAUCGCGGGAGCUCGCGCCGAAAGCGGGCUGAGAGGGCGGCUGGACCUUGUCGAGUCCGGUGCCGCCGACCGCACGAACCUGUCCGGGUAAUGCCGGCGUAGGGAGGGGAUGCCAUGUCGGC
RS 1 dot .((((……..))))(((((.(((….))))).)))..(((((((((((……..)))))..))))))..(((.(((….))).)))…..((((((((.((.(…..).))))))))))
RS 2 seq ACUUCCGUCAUAGGGGAGUAGCCAUUUCCGAGCCCGGCUCGGAAAGCUUGCGUCAACACACUUGGCCUCACACAGCCAUGGCGCAGGUACUGGCGGCCCGGGCAUGCCCCGAGGGCUGGCAGCCGGC
RS 2 dot ((((((…….))))))…..(((((((((…)))))))))((((((((((…….((((……..)))))))))))))).(((.(((((((((….)))…)))))).)))…..
RS 3 seq UAGCGAUACUCUGGAAAGUGUCGGGCCCGAAAGGGUCAGGCCGCCGACGGUGUAACCUCGACGAUUGGUCUUUUUUGGGCCGCUUCGAAGGGGGAAAACUCUCAGGUUUCCGUGACAGAGGGGGCACC
RS 3 dot …(((((((……)))))))((((((((((((((((..((.(((.(((…)))))).)).)))).))))))))))))……..(((((….)))))..((((((……..))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table