Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024340 Similarity: 0.985 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA024340
Gene: COQ3
MFE: -12.329
ENS: 0.939
Length: 55.
Predicted Ligands:
glutamine - 15/20
unknown - 3/20
fluoride - 1/20
 RS: URS000050FA1E_321967
MFE: -10.740
Ligand: fluoride
Species: Lactobacillus casei ATCC 334 Fluoride riboswitch
 RS: URS0000D6993C_12908
MFE: -25.158
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000C66990_12908
MFE: -10.727
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024340 URS000050FA1E_321967 URS0000D6993C_12908 URS0000C66990_12908
Length 55. 55. 55. 55.
Similarity - 0.985 0.984 0.984
Ensemble Norm 0.939 - - -
MFE -12.329 -10.740 -25.158 -10.727
Ligands - fluoride unknown glutamine
Gene COQ3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.056 11.003 3.001
Length SE - 0. 0. 0.
Lev Distance - 18. 18. 21.
UBS 5. 3. 3. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 1. 0.
H 3. 2. 2. 3.
BL 2. 1. 1. 1.
BR 2. 1. 0. 1.
UN 0.073 0.309 0.127 0.109

Sequences

Field Description
UTR seq + 25 accggaaaagaggugggaucguuugucgcgATGTGGAGTGGCCGTAAGCTGGGCT
UTR dot + 25 .((……..))(.(.(((((…..))))).).)…((((……..))))
RS 1 seq AAAUUAAAUGGCGAUGGUGUUCGCCUAUACGCAAGUUGAUGACACCUACCUUGAG
RS 1 dot ………(((((……)))))……((((.((……..)).))))..
RS 2 seq GGGUGCACGGUCCUGCCAGGAUCGGCAGGUCUUCGCGCUGGUCGGGCCGCCAGCG
RS 2 dot …….(((.((((((……))))))…)))(((((((……)))))))
RS 3 seq AUCGUUCAAUUUGCAGCUCGCAAAUCGGAAGUAGGUAUACCCGAAGGAACGCGGA
RS 3 dot ….(((.((((((…..)))))).))).(((….)))(((……..))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table