Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024360 Similarity: 0.984 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA024360
Gene: COQ7
MFE: -19.822
ENS: 0.957
Length: 85.
Predicted Ligands:
cyclic-di-GMP - 14/20
guanidine - 3/20
Mg2+ - 1/20
 RS: URS0000AB2F94_1042163
MFE: -25.745
Ligand: Mg2+
Species: Brevibacillus laterosporus LMG 15441 yybP-ykoY manganese riboswitch
 RS: URS0000D6CF71_12908
MFE: -21.867
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-AAU riboswitch
 RS: URS0000C19FF6_1618378
MFE: -12.071
Ligand: cyclic-di-GMP
Species: Candidatus Collierbacteria bacterium GW2011_GWA2_42_17 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024360 URS0000AB2F94_1042163 URS0000D6CF71_12908 URS0000C19FF6_1618378
Length 85. 86. 85. 84.
Similarity - 0.984 0.981 0.981
Ensemble Norm 0.957 - - -
MFE -19.822 -25.745 -21.867 -12.071
Ligands - Mg2+ GMP cyclic-di-GMP
Gene COQ7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.009 6.003 3.052
Length SE - 1. 0. 1.
Lev Distance - 20. 24. 24.
UBS 4. 4. 6. 4.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 0. 0. 1. 1.
H 3. 3. 3. 2.
BL 1. 0. 1. 0.
BR 1. 0. 2. 1.
UN 0.212 0.116 0.153 0.440

Sequences

Field Description
UTR seq + 25 gccaagggcacuauuggccaguuccguucaacgaagugguugcuuuuuuuaguuccggcaATGACTTTAGACAATATCAGTCGGG
UTR dot + 25 (((((……..)))))…………..(((((.((((((…………)))))).))))).(((…….)))…
RS 1 seq CUCUCAGUCAAAGGGGAGUAGCUUUUACAGCAAAGUCGUCAUUACAGGAUGUAUAUCCUCGGCUUUGUUGGCAACUGAUCGUUGUU
RS 1 dot (((((……..)))))………(((((((((((…….(((((….))))))))))))))))(((((…..))))).
RS 2 seq GUGGUGAUUGGCAGCGUUGAAUCGCCUUCUUCAACUGGUCACUUUGGUGGCGGAAAGCCAAUAGUGAAACCUAUCUGAGCAAGAU
RS 2 dot ..(((((((.(……).)))))))……….((((((((((((……..))))).)))))..)).((((…..))))
RS 3 seq UACGUCCUAGAAGGCAUUGAUUUAUAACCUCCAUUUGGUCACUUUGGUUAUAAGGAGCUAAUAGUGAAACCGUUCUAAAAAAAA
RS 3 dot …(((……)))…………………(((((((((((((……)))))).)))))..))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table