Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024361-0 Similarity: 0.976 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA024361-0
Gene: COQ7_0
MFE: -27.804
ENS: 0.879
Length: 95.
Predicted Ligands:
TPP - 5/20
glycine - 4/20
SAM - 4/20
 RS: URS0000D95615_40324
MFE: -37.517
Ligand: TPP
Species: Stenotrophomonas maltophilia TPP riboswitch (THI element)
 RS: URS0000D7E045_1970772
MFE: -27.540
Ligand: TPP
Species: candidate division KSB1 bacterium 4484_87 TPP riboswitch (THI element)
 RS: URS0000D97A39_1805051
MFE: -48.020
Ligand: glycine
Species: Betaproteobacteria bacterium CG2_30_68_42 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024361-0 URS0000D95615_40324 URS0000D7E045_1970772 URS0000D97A39_1805051
Length 95. 96. 93. 96.
Similarity - 0.976 0.975 0.975
Ensemble Norm 0.879 - - -
MFE -27.804 -37.517 -27.540 -48.020
Ligands - TPP TPP glycine
Gene COQ7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.004 7.003 4.007
Length SE - 1. 4. 1.
Lev Distance - 30. 26. 31.
UBS 7. 8. 7. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 3. 2. 2. 2.
H 3. 3. 3. 2.
BL 2. 3. 0. 2.
BR 1. 2. 2. 2.
UN 0.147 0.083 0.097 0.062

Sequences

Field Description
UTR seq + 25 gugcagugaugucacggcaggugcggccagcguuccgagucgaggacaguuggcgacacugaaaauucagATGACTTTAGACAATATCAGTCGGG
UTR dot + 25 .(((.(((….))).)))((((..((((((..(((…….)))..))))))..))))………..(((((.((…..))..)))))..
RS 1 seq CCCCUGAAGCGGGGGUGCCUGGCGUGAUCAGGCUGAGAGAGUCCCUUGGAACCUGAUCCGGUUUGCACCGGCGUAGGGAGCUUUGAGCAGCACCCG
RS 1 dot .(((……)))(((((..(.((.((((((((((((…….)))))..))))))))).)..)))))……(((.(((……))).))).
RS 2 seq AACAUUCCGAAGGGGUGGCCGGAUGGUCUGAGAGCAUACCCUUGGAACCUGAUCUGGACAAUACCAGCGGAGGGAUUCGGAAUUCCAGCGUUU
RS 2 dot ..((((((…))))))(((((((((((((((……..)))))).))..)))))).)……((((..((((((…))))))..)))).
RS 3 seq CCCGCUCUCGCGGGAGAGCGCGCACCGCGCGGCUGCGGGGCGCCGCCGAAGGCGCAGCACCCGUAAUCGCUCAGGCAAACGGACCGCGGGCGCUUC
RS 3 dot …((((((….))))))((((.((((((((.((((((((..((((…))))..)).)))))).))))……………))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table