Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024361-1 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA024361-1
Gene: COQ7_1
MFE: -21.237
ENS: 0.950
Length: 95.
Predicted Ligands:
TPP - 4/20
glycine - 4/20
SAM - 4/20
RS: URS0000B3859E_584609
MFE: -15.977
Ligand: TPP
Species: Tenacibaculum jejuense TPP
RS: URS00009DACCC_1663591
MFE: -34.
Ligand: glycine
Species: Magnetospirillum sp. XM-1 Glycine riboswitch
RS: URS0000BFF4CD_118168
MFE: -27.186
Ligand: glutamine
Species: Microcoleus chthonoplastes PCC 7420 Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024361-1 URS0000B3859E_584609 URS00009DACCC_1663591 URS0000BFF4CD_118168
Length 95. 95. 95. 94.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.950 - - -
MFE -21.237 -15.977 -34. -27.186
Ligands - TPP glycine glutamine
Gene COQ7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 4. 5.
Length SE - 0. 0. 1.
Lev Distance - 27. 28. 27.
UBS 7. 6. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 2. 2. 3. 3.
H 2. 2. 1. 2.
BL 4. 2. 3. 3.
BR 2. 2. 1. 3.
UN 0.084 0.095 0.084 0.085

Sequences

Field Description
UTR seq + 25 aucaguccgagccaagggcacuauuggccaguuccguucaacgaagugguugcuuuuuuuaguuccggcaATGACTTTAGACAATATCAGTCGGG
UTR dot + 25 ….(((.((((.(((((((……((((.(((……..))).)))))))))))….)))).)))..(((((.((…..))..)))))..
RS 1 seq UAUAAACUUUAGGAGUAGCUAGAUUACUAGUUUGAGAAAUAUCCUUAGAACCUGAUUUGGUUAAUACCAGCGGAGGGAAAAGUUAUCUUAACUUU
RS 1 dot ……((((.(((.(((((((((((….((((((…….))))))…))))))))))).).))…))))…(((((((…)))))))
RS 2 seq AUGAUCCCCGUGGGAGAGACCGGCCCUUUAUCGGGUCGGCGCCGAAGGAGCAACCGCCCCUGGAAACUCUCAGGCAAAAGGACCGCGGGGGGAUG
RS 2 dot ….((((((((((((((.((((………(((.(((.(((….).))..))))))))))…)))))………..)))))))))….
RS 3 seq AUCGUUCAUCUCUCUAGACAUCAGUCAGUUAGCAAUUAGCCGUGAAGGAUGAUUAGGGAGACGGAAGUAGGGGCAACUCCCGAAGGAACGCGCC
RS 3 dot ….(((.(((((((((.((((..(((((((…..))))..)))..)))).))))))))).)))….((.((…(((….)))..)).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table