Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024367 Similarity: 0.992 Similarity: 0.991 Similarity: 0.991
UTR: 5HSAA024367
Gene: COQ7_2
MFE: -9.344
ENS: 0.902
Length: 44.
Predicted Ligands:
preQ_1 - 18/20
SAM - 2/20

 RS: URS0000AB877A_272558
MFE: -6.509
Ligand: preQ_1
Species: Bacillus halodurans C-125 PreQ1 riboswitch
 RS: URS0000DB5D0C_1852522
MFE: -10.175
Ligand: preQ_1
Species: Paenibacillus aquistagni PreQ1 riboswitch
 RS: URS0000DF2C5A_44250
MFE: -10.175
Ligand: preQ_1
Species: Paenibacillus alvei PreQ1
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024367 URS0000AB877A_272558 URS0000DB5D0C_1852522 URS0000DF2C5A_44250
Length 44. 44. 44. 44.
Similarity - 0.992 0.991 0.991
Ensemble Norm 0.902 - - -
MFE -9.344 -6.509 -10.175 -10.175
Ligands - preQ_1 preQ_1 preQ_1
Gene COQ7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.074 6.101 6.101
Length SE - 0. 0. 0.
Lev Distance - 10. 10. 10.
UBS 3. 2. 1. 1.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 1. 1. 1.
BL 0. 1. 0. 0.
BR 1. 1. 0. 0.
UN 0.205 0.477 0.523 0.523

Sequences

Field Description
UTR seq + 25 aucaguccgagccaagggcATGACTTTAGACAATATCAGTCGGG
UTR dot + 25 .(((((((…….)))).)))…..(((…….)))…
RS 1 seq GUGAGAGAGGUUCGCGAACUCCCUCUAUAAAAAACUAAGGCAAG
RS 1 dot ..(((.(((………))).)))……………….
RS 2 seq GCGGGAGAGGUUCGCAAUCUCCCUCUAUAAAAAACUAAGGUCUA
RS 2 dot ..((((((………))))))…………………
RS 3 seq ACGGGAGAGGUUCGCAAUCUCCCUCUAUAAAAAACUAAGGCUGA
RS 3 dot ..((((((………))))))…………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table