Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024370 Similarity: 0.978 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA024370
Gene: COQ9
MFE: -48.558
ENS: 0.975
Length: 106.
Predicted Ligands:
TPP - 13/20
glycine - 2/20
SAM - 1/20
 RS: URS0000C10EBA_502682
MFE: -36.156
Ligand: TPP
Species: Erythrobacter sp. K7-2 TPP riboswitch (THI element)
 RS: URS0000ABA814_278197
MFE: -25.175
Ligand: TPP
Species: Pediococcus pentosaceus ATCC 25745 TPP riboswitch (THI element)
 RS: URS0000C2E171_1519493
MFE: -41.566
Ligand: glycine
Species: Streptomyces sp. NRRL B-3648 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024370 URS0000C10EBA_502682 URS0000ABA814_278197 URS0000C2E171_1519493
Length 106. 106. 106. 105.
Similarity - 0.978 0.977 0.976
Ensemble Norm 0.975 - - -
MFE -48.558 -36.156 -25.175 -41.566
Ligands - TPP TPP glycine
Gene COQ9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 1.001 11.001
Length SE - 0. 0. 1.
Lev Distance - 26. 31. 26.
UBS 9. 10. 9. 10.
BS 0. 0. 0. 0.
ILL 1. 3. 1. 0.
ILR 2. 3. 2. 2.
H 2. 2. 2. 2.
BL 4. 3. 4. 7.
BR 4. 5. 3. 4.
UN 0.057 0.075 0.085 0.095

Sequences

Field Description
UTR seq + 25 agcgacgacuuccgcccuccuuagggccguggucccguagcuaccggucgcgucgccgugggcgacgugcccgcuuccaaaATGGCGGCGGCGGCGGTATCTGGTG
UTR dot + 25 ……((((.(.(((((….))))).).))))(..(((.((((.(((((((((((((((((…..))))))………))))))).)))))))).)))..)
RS 1 seq UUUCCAACCCCGGGGAGCCAUGAGGCUGAGAGGGCGGUUCGAGUCCGCCGACCCGUCGAACCUGAACCGAUUAGCAUCGGCGGAGGGAGUGGGCAGACGGCAACGG
RS 1 dot ……..(((….((((….))))….)))(.((((..(((.(((.(((((((((..((((…..))))..)))))))…..)).))).))).).))).)
RS 2 seq UAUCUGCACUAGGGGUGUUCUUAGAAGAACUGAGAUACGCUUGUUCAGCGUGAUCCCUUUGAACCUGUAAGUUAGUACUUGCGAAGGAAAGUGUUUAAUUGUUGAA
RS 2 dot ………((((.(((.((((((…..))))))))).))))((((((((((.(.((((…(((((((((….))))))..))))))).).)))..)))))))
RS 3 seq UGAAUCCGCGCGGGAGAGUUCCCAGCCGUACGUCUGUGCCGCUGGGGCGCCGAAGGAGCAAGUCCCUCCCUUGAAUCUCUCAGGCCCCGUUACCGCGCGGGCGAG
RS 3 dot ……((.((((((….)))).))))..(((((((((.(.((((((.(.((.(((.((((…….))))..))).)).)))))))…).)))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table