Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024412 Similarity: 0.971 Similarity: 0.971 Similarity: 0.970
UTR: 5HSAA024412
Gene: CORO1B
MFE: -50.350
ENS: 0.849
Length: 129.
Predicted Ligands:
TPP - 6/20
cobalamin - 4/20
SAM - 4/20
 RS: URS0000C53D73_1736511
MFE: -67.325
Ligand: zmp-ztp
Species: Rhizobacter sp. Root29 ZMP/ZTP riboswitch
 RS: URS0002325711_1519495
MFE: -48.984
Ligand: cobalamin
Species: Streptomyces sp. NRRL F-6491 Cobalamin riboswitch
 RS: URS0000C3063C_1547516
MFE: -66.827
Ligand: SAM
Species: Luteimonas sp. FCS-9 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024412 URS0000C53D73_1736511 URS0002325711_1519495 URS0000C3063C_1547516
Length 129. 128. 129. 130.
Similarity - 0.971 0.971 0.970
Ensemble Norm 0.849 - - -
MFE -50.350 -67.325 -48.984 -66.827
Ligands - zmp-ztp cobalamin SAM
Gene CORO1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 11. 3.001
Length SE - 1. 0. 1.
Lev Distance - 32. 33. 37.
UBS 12. 12. 13. 12.
BS 0. 0. 0. 0.
ILL 3. 4. 5. 3.
ILR 5. 3. 3. 4.
H 1. 1. 1. 1.
BL 6. 5. 7. 5.
BR 6. 4. 5. 5.
UN 0.078 0.039 0.078 0.046

Sequences

Field Description
UTR seq + 25 auuaugaggagcaagaacgcgaaggggccucggguccgcuaggccgggauccggagccgcccgaagccggugccgcagcccccugcgcccccggugcccccgacATGTCCTTCCGCAAAGTGGTCCGGC
UTR dot + 25 …….(((.((…..(((.((((((.(((((..((((.(((((((….((.((.(((((….))).)).))..)).)))).)))…))))..)))))…)))))).)))….)).)))…
RS 1 seq CGCGGGCUGCGCAACUGGCGAUGGGGCACCGGGCAUCAAGCCCGCGAGCCUGAGGUGGUGAACCACCGGGAAGCGCAGCCGGUUCCGGGUUUCCGGCACCGGUUCAGCCGUUCGCCUGGGCAGCCCUG
RS 1 dot …(((((((.((…(((((.(.((((((((((…(((((((.(((((…(((.(((..((….))…))).)))))))))))))))…)).)))))…))).)))))))).)))))))..
RS 2 seq ACAUGUAUGCUCGUCCUCGCUGUCGACGCAGGGGAAUCCGGCGCGAAUCCGGAACUGUCCCGCAACGGUGUACUUCGUGCGGCUUCGUCCGGAGUGAGUCCGAACACCUGCCGACGGCGCGCCCGGUCC
RS 2 dot ……..((.((..(.((((((((..(((((….((.(((.((..(((((.((.(..((((.((((……))))))))..).))))))).)).))).))…))))))))))))).)..))))..
RS 3 seq CAUCCAUCGAGACCGGCGGAGGGACAGGCCCUUUGAUGCCGGGGCAACCUGAUGGGAUCCGCGCACCGUGCGGACCCCCGUCGCGGUGCCAAGUCCUGCGGGGACCUGCGCGUCCACCGGAAGAUGGUCA
RS 3 dot …(((((….((((.(((.(..((((((((…..((.(((((.((((((((((.(((((((…)))))))..))))))).))))))….)).)))))).))))..).))).))))..)))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table