Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024413 Similarity: 0.963 Similarity: 0.959 Similarity: 0.957
UTR: 5HSAA024413
Gene: CORO1B_0
MFE: -57.805
ENS: 0.837
Length: 156.
Predicted Ligands:
cobalamin - 7/20
FMN - 5/20
molybdenum - 3/20
 RS: URS000232F419_1797644
MFE: -51.032
Ligand: cobalamin
Species: Chloroflexi bacterium RBG_16_51_16 Cobalamin riboswitch
 RS: URS0000DA156E_1903117
MFE: -56.127
Ligand: FMN
Species: Williamsia sp. 1138 FMN riboswitch (RFN element)
 RS: URS0002329702_99598
MFE: -37.290
Ligand: cobalamin
Species: Calothrix sp. PCC 7507 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024413 URS000232F419_1797644 URS0000DA156E_1903117 URS0002329702_99598
Length 156. 156. 158. 157.
Similarity - 0.963 0.959 0.957
Ensemble Norm 0.837 - - -
MFE -57.805 -51.032 -56.127 -37.290
Ligands - cobalamin FMN cobalamin
Gene CORO1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.007 3. 18.002
Length SE - 0. 4. 1.
Lev Distance - 47. 48. 48.
UBS 9. 8. 9. 7.
BS 4. 5. 5. 5.
ILL 3. 2. 3. 4.
ILR 1. 0. 1. 2.
H 3. 2. 2. 2.
BL 6. 6. 6. 3.
BR 6. 5. 5. 5.
UN 0.083 0.167 0.063 0.127

Sequences

Field Description
UTR seq + 25 caagaacgcgaaggggccucggguccgcuacccaauccuggagacuccugcggaugccauuaugaggaggccgggauccggagccgcccgaagccggugccgcagcccccugcgcccccggugcccccgacATGTCCTTCCGCAAAGTGGTCCGGC
UTR dot + 25 .(((.(((.(..(((((.((((((..(((.((..(((((((…(((((……………))))).)))))))..))))).)))))).(((((.(.(((((….))))).).))))))))))…).))).)))((((…))))……
RS 1 seq CAAUUGAAUAGCGAACAGGGUGCCUCAACUCCCGGAUGGGGAGGCUCAAAGGCGAAGCCGGUGCAAGUCCGGUGCUGUCCCGCAACUGUAAGUUCAGGAUUUGAGAUUUAUCAAUCCUGAACGAGUCAGGCCGCCCGCCCUGGUCAGCUCACCCCA
RS 1 dot ………(((((.((((((((((..((((.(((.((.((.(((…..(((…(((((…….))))))))))))).)).)))…((((((((.((((……)))))))))))))))).))))…..)))))).)).)))…….
RS 2 seq GGAAGUUCUCGGGGCGGGGUGUGAUUCCCCACCGGCGGUAAAGGUGAAGACCUGGUUUUUCUCCUAGCCCGCGAGCGCCUUCACCUCGGUGGAGGGUCCAGCAGAUUCCGGUGAGAUCCCGGAGCCGACGGUUACAGUCCGGACGUGAGAGAACACCA
RS 2 dot ((…((((((.(.((((.((((((((((((((((.(((.((((((…….((((……..))))……)))))).)))))))))).))(((..((….(((((.(….)))))))).)))))))))).))))..).))))))….)).
RS 3 seq AACAAGUCAUUCGGUUUUGGUGGGUAUCAGCCACCAAAGGUAACGGGGAAAGUUAGGUGUAAGUCCAACGCUGUCCCGCAACUGUGAACUAACUUGAGAUUUUAGAGCCAUCUCAAAUUGAGUGAGUCAGAACGCCCGCCAAAGGUGACUUUUUUUU
RS 3 dot …(((((((….(((((((((((.((.(((((((..(((..(((((..(((..((…….))…))).)))))..))).))…(((.(((((((………))))))).))).))).))..))..))))))))))))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table