Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024419 Similarity: 0.960 Similarity: 0.960 Similarity: 0.959
UTR: 5HSAA024419
Gene: CORO1B_1
MFE: -60.954
ENS: 0.690
Length: 158.
Predicted Ligands:
cobalamin - 11/20
FMN - 3/20
SAM - 3/20
 RS: URS0000C7D47C_1330036
MFE: -44.292
Ligand: FMN
Species: Osedax symbiont Rs1 FMN riboswitch (RFN element)
 RS: URS000231C857_525903
MFE: -60.331
Ligand: cobalamin
Species: Thermanaerovibrio acidaminovorans DSM 6589 Cobalamin riboswitch
 RS: URS0000DA8B37_1797746
MFE: -58.904
Ligand: FMN
Species: Curvibacter sp. GWA2_63_95 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024419 URS0000C7D47C_1330036 URS000231C857_525903 URS0000DA8B37_1797746
Length 158. 157. 160. 158.
Similarity - 0.960 0.960 0.959
Ensemble Norm 0.690 - - -
MFE -60.954 -44.292 -60.331 -58.904
Ligands - FMN cobalamin FMN
Gene CORO1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 4.002 12.002
Length SE - 1. 4. 0.
Lev Distance - 50. 46. 48.
UBS 13. 13. 14. 15.
BS 0. 0. 0. 0.
ILL 7. 6. 6. 7.
ILR 4. 5. 4. 6.
H 1. 1. 1. 1.
BL 5. 6. 6. 5.
BR 3. 4. 4. 5.
UN 0.057 0.051 0.013 0.013

Sequences

Field Description
UTR seq + 25 acccaauccuggagacuccugcggaugccauuaugaggagcaagaacgcgaaggggccucggguccgcuaggccgggauccggagccgcccgaagccggugccgcagcccccugcgcccccggugcccccgacATGTCCTTCCGCAAAGTGGTCCGGC
UTR dot + 25 ……..(((((.(((..((((((……….((((.((….((….(((((.(((((..(((.(((..(((…(((.((((……..)))).)))…)))))))))..))))).)))))))…)))))))))))).)))..))))).
RS 1 seq UUUCGUUCUCGGGGCGGGGUGUAAUUCCCCACCGGCGGUAAGGAAGUGAUUCUAAGCCCGCGAGCGCCUGAUAUAGUUAACAUAAUAUAUAUUAGGGUCAGCAGAUCUGGUGUGAUUCCAGAGCCGACGGUGAUAGUCCGGAUGAUAGAGAACACUA
RS 1 dot ….((((((….((((.(((…….(((((.((((..((.(((.((.(((…..((..((.(((((((((..(……)..)))))))))))..))…..))).)).)))))…)))).)))))))).))))…….))))))….
RS 2 seq ACAUCUUUGUUAGCCUCCGGUGAACGGGAAGUCCGGUGCGAAUCCGGCGCGGCCCCGCCACUGUGAGCCCGACGAGUCCGCCGAUGCCACUGGGUAUGCCUGGGAAGGGGCGGAUAGGAUGAAGGCCAGCCAGGAGACCGGCCGGGGGCUGAAGGGAAGG
RS 2 dot .(.(((((.(((((((((((…………(((((.(…((((((..((((.((.(.((((..((((……((((…(((((….)))))…))))…))))..))))).))..)))).))).))))))))))))))))))))))))).).
RS 3 seq CCGCGUUCUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAUCUGUGGCUUGACCUCAGCAGCCCGCGAGCGCCCACGCCAGCCUCUGCCAGCGUGGGGUCAGCAGAUCUGGUGAGAUGCCAGAGCCGACGGUCAUAGUCCGGAUGAAAGAGAUCGCGC
RS 3 dot .((((.((((….(((((((………((((.(((…((.((((…..((((.(((..(((..((.(((((((..((….))..)))))))))..)).)..))).))))..)))).))))).)))))))..))))…….)))).)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table