Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024462 Similarity: 0.960 Similarity: 0.954 Similarity: 0.947
UTR: 5HSAA024462
Gene: CORO7
MFE: -61.397
ENS: 0.899
Length: 145.
Predicted Ligands:
cobalamin - 8/20
TPP - 5/20
FMN - 3/20
 RS: URS0002320A2A_656024
MFE: -59.073
Ligand: cobalamin
Species: Frankia symbiont of Datisca glomerata Cobalamin riboswitch
 RS: URS0000BECE69_675120
MFE: -47.975
Ligand: TPP
Species: Dothistroma septosporum NZE10 TPP riboswitch (THI element)
 RS: URS000232E517_670487
MFE: -59.668
Ligand: cobalamin
Species: Oceanithermus profundus DSM 14977 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024462 URS0002320A2A_656024 URS0000BECE69_675120 URS000232E517_670487
Length 145. 143. 144. 146.
Similarity - 0.960 0.954 0.947
Ensemble Norm 0.899 - - -
MFE -61.397 -59.073 -47.975 -59.668
Ligands - cobalamin TPP cobalamin
Gene CORO7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 27. 25.002
Length SE - 4. 1. 1.
Lev Distance - 44. 42. 53.
UBS 15. 15. 13. 16.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 2.
ILR 0. 1. 1. 3.
H 3. 3. 2. 2.
BL 10. 8. 8. 7.
BR 11. 10. 7. 10.
UN 0.110 0.063 0.090 0.062

Sequences

Field Description
UTR seq + 25 gugaccgcggcauugggucccggguggggccgaggcagcgggagucgcgguugcucagcgugcaccugagacccgacgcccgggguccucgaagacgcguccgccgccgugcccgucgccATGAACCGCTTCAGGGTGTCCAAGT
UTR dot + 25 ..((((.((((.(((((((.((((((.(((.((.(((((.(……).))))))).)).).)))))).))))))).)).)).))))…….(((.((.((….)).)).)))((((.((((….)))).))))…….
RS 1 seq GGCUUGACGGCGGGGUUGGGUGCUGCUUCUCUCAGACUGUUCGAGUCGGUGGAAGCCGGUGUGAAUCCGGCACGGUCGCGCCACUGUCACCGGAGCUACCCCAGAGGUGGCACCGGAAGUCAGACCCAUCGCUGGGACAAGUC
RS 1 dot (((.(((((((.(((((.(..(((((((((.((.((((…..)))))).)))))).))).).))))).)).).)))).))).(((.(.((((.((((((…..)))))).))))..).))).((((….))))…….
RS 2 seq UAUAGCAUGAGCCGGUGCCUGGCUCUCUCGACAGACGCUUCGAAUGAUAUUCAAUUCGAAGCUCUAUCAGAGGCCUCGCUGAGAUCAUACGGCUGAACUUGAUCUGGACAAUGCCAGCGAAGAAGAAUCAUGCUCUGCCCCAUA
RS 2 dot ……((((.((((((…(((.((((.((.(((.(((((((((……..)))))))))))).))))))))).))))).).))))..(((.((.(.((((((((……))))………)))).).)).)))…..
RS 3 seq CUCGGCCUCGAGGUCCCUGGUGCCUGGCGCGCGUAGCCCAGGCUUAAAGUGGGGAAGUCCGGUGAGAGUCCGGCGCUGUCCCGCAACGGUCAUGGCUCCCCCAGAGGAGCACGAGCCCGAACACCUGCCAGGGAAGCCCCGCACCC
RS 3 dot .((((.((((.(.(((((((.((((((((((.(((((((.(((((..(.((((….)))).)..))))).)).)))).).)))….)))).)))….)))).))).).)))).))))…..(((..(((….))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table