Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024464 Similarity: 0.979 Similarity: 0.978 Similarity: 0.976
UTR: 5HSAA024464
Gene: CORO7_0
MFE: -36.278
ENS: 0.998
Length: 103.
Predicted Ligands:
TPP - 9/20
purine - 6/20
homocysteine - 1/20
 RS: URS0000C53029_1284
MFE: -18.092
Ligand: TPP
Species: Staphylococcus hyicus TPP riboswitch (THI element)
 RS: URS0000C0C73C_1423719
MFE: -20.465
Ligand: TPP
Species: Lactobacillus algidus DSM 15638 TPP riboswitch (THI element)
 RS: URS0000D888A2_1214604
MFE: -22.031
Ligand: purine
Species: Tumebacillus algifaecis Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024464 URS0000C53029_1284 URS0000C0C73C_1423719 URS0000D888A2_1214604
Length 103. 104. 101. 102.
Similarity - 0.979 0.978 0.976
Ensemble Norm 0.998 - - -
MFE -36.278 -18.092 -20.465 -22.031
Ligands - TPP TPP purine
Gene CORO7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 9.008 4.
Length SE - 1. 4. 1.
Lev Distance - 26. 21. 29.
UBS 9. 10. 7. 10.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 2. 1. 1. 3.
H 2. 2. 2. 2.
BL 4. 5. 2. 5.
BR 4. 5. 4. 4.
UN 0.078 0.096 0.168 0.069

Sequences

Field Description
UTR seq + 25 agucgcgguugcucagcgugcaccugagacccgacgcccgggguccucgaagacgcguccgccgccgugcccgucgccATGAACCGCTTCAGGGTGTCCAAGT
UTR dot + 25 .(.((((((.((…(((((….((((((((……..))))).)))….)))))..)).)))))))..(.((((.((((….)))).)))).)…..
RS 1 seq UACAAGUGCUAGGGGUGCUCUUAAAUGAGCUGAGAAAGACGUCAUCUUAACUCUUUGAACCUGAAGUGGUUAGUACCAACGAAGGGAAGCCGUAUGUGAACACA
RS 1 dot (((((.((((..((((….(((((.(((.(((((………))))).))))))))))))..)))).)).)))…(((.(.((…)).).)))…….
RS 2 seq ACCAACACAAAGGGGAGCCGAUAUCUGGCUGAGAGUGAAGAAAUUCAGACCCUUGGAACCUGUUUGUUAAUGCAAACGUAGGAAUUGUGUGUAGAAGAUUA
RS 2 dot ……(((((.(((..((((…..(((((((……….))))).)).))))..))).)))))…((((.(((…….))).))))……..
RS 3 seq CCAACCAAUUGAAUAAGCUCUCGUAUAAUCGUGGGGAUAUGGCCCACAAGUUUCUACCAGGCUACCGUAAAUGGCUUGACUACGAGUGAAGCACACCUCGCA
RS 3 dot .((((((.(((….(((.((.(((.(((.(((((…….)))))..)))..))).)))))….))).))).)))….((((((…..))).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table