Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024467 Similarity: 0.990 Similarity: 0.990 Similarity: 0.989
UTR: 5HSAA024467
Gene: CORO7_1
MFE: -10.944
ENS: 0.988
Length: 51.
Predicted Ligands:
glutamine - 16/20
unknown - 4/20

 RS: URS0000E603A5_35799
MFE: -15.309
Ligand: unknown
Species: Nitrosospira briensis nhaA-I RNA
 RS: URS0000D68E09_12908
MFE: -23.070
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000E608E8_80878
MFE: -13.470
Ligand: unknown
Species: Acidovorax temperans nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024467 URS0000E603A5_35799 URS0000D68E09_12908 URS0000E608E8_80878
Length 51. 51. 52. 52.
Similarity - 0.990 0.990 0.989
Ensemble Norm 0.988 - - -
MFE -10.944 -15.309 -23.070 -13.470
Ligands - unknown unknown unknown
Gene CORO7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0. 3.003 1.001
Length SE - 0. 1. 1.
Lev Distance - 13. 11. 13.
UBS 5. 5. 4. 5.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 3. 3. 2. 3.
BR 3. 3. 2. 2.
UN 0.137 0.157 0.192 0.173

Sequences

Field Description
UTR seq + 25 acgcguccgccgccgugcccgucgccATGAACCGCTTCAGGGTGTCCAAGT
UTR dot + 25 (((.((.((….)).)).)))((((.((((….)))).))))…….
RS 1 seq GGGUGCGCACACGUCGUGUGUAGCAGGUACAGCGUUGGUCGGGCCGCCACG
RS 1 dot .(.(((((((…..))))))).).(((.(.((….)).).)))……
RS 2 seq GGGUGCCGGGCCACGAGGCGCGGCAGGUUCUGCACUGGUCGGGCCGCCAGCG
RS 2 dot …(((((.(((….))).)))))(((((.((….)).)))))…….
RS 3 seq GGGUGUCUGCGCAAAUCGGCGCAACAGGUACAGCGAUGGUCGGGCCGCCACG
RS 3 dot …(((.(((((……))))))))(((.(.((….)).).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table