Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024528 Similarity: 0.976 Similarity: 0.975 Similarity: 0.973
UTR: 5HSAA024528
Gene: COX17
MFE: -35.468
ENS: 0.835
Length: 111.
Predicted Ligands:
TPP - 17/20
methionine - 1/20
zmp-ztp - 1/20
 RS: URS0000C3EF1B_1125712
MFE: -48.513
Ligand: TPP
Species: Olsenella profusa F0195 TPP riboswitch (THI element)
 RS: URS0000DB0C89_1278073
MFE: -49.185
Ligand: TPP
Species: Myxococcus stipitatus DSM 14675 TPP riboswitch (THI element)
 RS: URS0000C14149_316330
MFE: -41.903
Ligand: TPP
Species: Microbispora sp. ATCC PTA-5024 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024528 URS0000C3EF1B_1125712 URS0000DB0C89_1278073 URS0000C14149_316330
Length 111. 111. 111. 111.
Similarity - 0.976 0.975 0.973
Ensemble Norm 0.835 - - -
MFE -35.468 -48.513 -49.185 -41.903
Ligands - TPP TPP TPP
Gene COX17 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.001 8.003 5.
Length SE - 0. 0. 0.
Lev Distance - 26. 31. 34.
UBS 9. 7. 8. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 2. 1. 0. 3.
H 4. 4. 5. 3.
BL 3. 0. 2. 3.
BR 2. 2. 1. 3.
UN 0.072 0.108 0.126 0.063

Sequences

Field Description
UTR seq + 25 ccggaagugacugcggacgaaucggcguuugccgaggcuggcauagauuuggcugucuccgcucauagcugcuuuuggcgcgaaagATGCCGGGTCTGGTTGACTCAAACC
UTR dot + 25 (((.(……).)))..(..(((((….)))))..)……(((((((((.((((.((((((……….))).)))..)))))))))))))((((……))))
RS 1 seq GCCCUCGAACAGGGGAGCUGGCGCACGCCGGCUGAGAGGGGGUCCCACGCGGCCCCGACCCUUAUACCUGAUCUGGGUAAUGCCAGCGUAGGGACUAUGGCCACAACGGCG
RS 1 dot .((((……))))(((((((….)))))))…….(((((((((((((….((((………….))))…))).)))).))))))…(((…..))).
RS 2 seq CCCAGUCGCUAGGGGUGCCCCUCGAGAGGGGCUGAGACGGCCGCGCGGCGCGGCCAACCCUUGGAACCUGAACCGGGUCAUACCGGCGGAGGGAAGCGGCAUGGAGCCCAC
RS 2 dot (((……..)))..((((((….))))))……(((((((…)))))))..(((((.(……..((((……))))).)))))..(.(((…..))))..
RS 3 seq CGUAAGACGCGCGGGAGCCCGGCGGCCGGGCUGAGAGGAGAGCGGAGGCUCUCGACCGCCAGACGACCUGAUCCGGGUAAUGCCGGCGAAGGGAGCGCUGUGUCAGAUCCG
RS 3 dot (((…….)))..(((((((…)))))))….(((..(((.((((((((…((((.(.(((((((…)))))..))).))))..)))))).)).)))….))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table