Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024565 Similarity: 0.983 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA024565
Gene: COX6C
MFE: -15.387
ENS: 0.868
Length: 85.
Predicted Ligands:
zmp-ztp - 10/20
cyclic-di-GMP - 4/20
GMP - 2/20
 RS: URS0000D8580B_1739479
MFE: -36.392
Ligand: zmp-ztp
Species: Actinomyces sp. HMSC065F12 ZMP/ZTP riboswitch
 RS: URS00007D5888_1476857
MFE: -17.809
Ligand: GMP
Species: Bacillus sp. B-jedd c-di-GMP-II
 RS: URS0000C422F6_1262970
MFE: -25.799
Ligand: zmp-ztp
Species: Subdoligranulum sp. CAG:314 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024565 URS0000D8580B_1739479 URS00007D5888_1476857 URS0000C422F6_1262970
Length 85. 85. 84. 85.
Similarity - 0.983 0.982 0.981
Ensemble Norm 0.868 - - -
MFE -15.387 -36.392 -17.809 -25.799
Ligands - zmp-ztp GMP zmp-ztp
Gene COX6C - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 4.001 8.007
Length SE - 0. 1. 0.
Lev Distance - 19. 21. 22.
UBS 7. 7. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 3. 1. 3.
ILR 1. 0. 2. 0.
H 1. 1. 1. 1.
BL 5. 3. 4. 4.
BR 4. 5. 3. 5.
UN 0.165 0.141 0.190 0.082

Sequences

Field Description
UTR seq + 25 cuuuagucaggaaggacguugguguugagguuagcauacguaucaaggacaguaacuaccATGGCTCCCGAAGTTTTGCCAAAAC
UTR dot + 25 ………((.(((((.((((.((((.((.(((..(((…………))).))))).))))..)))).))))).))…..
RS 1 seq UGAAUCUGUCGCAACUGGCGAACAGGUGGGAUGACCACCGGGGAGCGAAAUAGGGUUGUCGCGGUCGCCCGCCUGGGCCACGCAA
RS 1 dot ……….((…((((…((((((((.(((((..(((.((.(…….).)).))).))))))))))))).)))).))..
RS 2 seq UUAUCCUUGGGAAGCGUUGAAGUAUAGCCUCUACCUGGACACUUAGGCUAUAUGGAGCUAGUAGUGUAACCGGCCCUCUUAAUA
RS 2 dot ……..(((..(.((((.(.(((((.((((((((((….)))))…..)))))))).)).).)))))..)))……..
RS 3 seq UACGUUGCGUAUGACUGACGGAAAUUCGGCAGGUUACUGCGGGGGAGUACGCAAACGGUUCAAGCCGUCCGUCUGGGCAAUUUCU
RS 3 dot …(((((.((.(((.(((((…((.(((..(((..((((……..))))))).))).)).))))).))))).)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table