Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024689 Similarity: 0.971 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA024689
Gene: CPLX3
MFE: -58.246
ENS: 0.845
Length: 119.
Predicted Ligands:
SAM - 7/20
methionine - 5/20
glycine - 3/20
 RS: URS0000ABC266_485918
MFE: -41.526
Ligand: SAM
Species: Chitinophaga pinensis DSM 2588 SAM riboswitch (S box leader)
 RS: URS0000DAF71B_546871
MFE: -48.785
Ligand: methionine
Species: Friedmanniella luteola S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000D9A3F1_393003
MFE: -45.726
Ligand: SAM
Species: Chitinophaga ginsengisegetis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024689 URS0000ABC266_485918 URS0000DAF71B_546871 URS0000D9A3F1_393003
Length 119. 120. 118. 120.
Similarity - 0.971 0.970 0.969
Ensemble Norm 0.845 - - -
MFE -58.246 -41.526 -48.785 -45.726
Ligands - SAM methionine SAM
Gene CPLX3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.006 4. 6.006
Length SE - 1. 1. 1.
Lev Distance - 37. 38. 38.
UBS 10. 10. 11. 9.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 1.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 3. 2. 4. 3.
BR 4. 3. 3. 2.
UN 0.059 0.133 0.059 0.133

Sequences

Field Description
UTR seq + 25 agcuguccgcgaaaccuagugcugaaguaggcgcggacgugcccggugccuggcgcgugguagcaggcgcccggugccccggccggcgaagaccATGGCGTTCATGGTGAAGACCATGG
UTR dot + 25 .((((((((((…((((.(…..).)))))))))))).))((((((((.(((((.((….)).))))).)))……)))))……((((((..((((…))))..))))))
RS 1 seq GACUUAUCCAGAAAGGCGGAGGGACUUGGCCCUGCGAUGCCUUAGCAACCAACCUGCAGAAAUGUAGGGAAAGGUGCUAAUUCCGGCCCCGGUUAUACGAUAACCGAGGGAAGAUAAGUU
RS 1 dot ….(((((((…(((.(((…))).)))))).))))..(((((.(((..((((((….))))))….))))))))…(..((((((((((…))))))).)))..)…….
RS 2 seq GGUCAUGAGUGCCAGCUGCACGAGCCCCGGCUCGCUGGCCAGCAACCCUCCGGUACGGCGGGGUGCUCCGGGUGACGACCAGGUCGGCGACCCCCUCGGGCGUCGGCAAGCGUCCAGU
RS 2 dot ((((((((((….(((…..)))….))))).)))))((((.(((.(((…))).))).))))….(.((((..(..(((((((.(((….))))))))))..))))))…
RS 3 seq CACUUAUCCAGAAAGGCGGAGGGACUUGGCCCUGCGAUGCCUUAGCAACCUUUCCUGAUUAUUACAAUCAGGAAAAAGGUGCUAAUUCCUGCCCCGGUGCAAAUCGGGGAAAGAUAAGUU
RS 3 dot ….(((((((…(((.(((…))).)))))).))))..(((((.(((((((((((((…..)))))))))..)))))))))…((.(((((((….)))))))..))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table