Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024789 Similarity: 0.982 Similarity: 0.981 Similarity: 0.978
UTR: 5HSAA024789
Gene: CPNE5
MFE: -20.081
ENS: 0.981
Length: 92.
Predicted Ligands:
TPP - 9/20
glycine - 7/20
SAM - 3/20
 RS: URS0000D8D044_1986702
MFE: -22.894
Ligand: TPP
Species: Flavobacteriaceae bacterium TMED120 TPP riboswitch (THI element)
 RS: URS0000C3449A_1236550
MFE: -30.384
Ligand: TPP
Species: Kocuria palustris PEL TPP riboswitch (THI element)
 RS: URS0000ABB376_717231
MFE: -27.716
Ligand: TPP
Species: Flexistipes sinusarabici DSM 4947 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024789 URS0000D8D044_1986702 URS0000C3449A_1236550 URS0000ABB376_717231
Length 92. 91. 93. 92.
Similarity - 0.982 0.981 0.978
Ensemble Norm 0.981 - - -
MFE -20.081 -22.894 -30.384 -27.716
Ligands - TPP TPP TPP
Gene CPNE5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 5.015 2.020
Length SE - 1. 1. 0.
Lev Distance - 20. 23. 29.
UBS 7. 6. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 0. 1.
ILR 2. 1. 2. 2.
H 2. 2. 3. 2.
BL 4. 2. 5. 3.
BR 3. 2. 2. 2.
UN 0.272 0.242 0.151 0.130

Sequences

Field Description
UTR seq + 25 agucgcuccggaggaggcgugaaucgcgcagggauugacuaauuugggguggggggugcggugggcgATGAAGAAAAAGAAATACGTGAATT
UTR dot + 25 ..((((.((……)).))))(((((.((.(.(((..(((……..)))..))).)..)).)))))…………………..
RS 1 seq UCCAUCUCAAAGGGGUGCCCUAGUGGCUGAGAUUAUACCCAUUGAACCUGGGCAGGUAAUGCUGCCAAGGGACAUUUUUNGCAAUUUAUUA
RS 1 dot ..((((((…))))))((((..((((.(..(((((.((((…….))))…))))).).))))))))………………..
RS 2 seq GCUGCGGACACGGGGUGCGCCGCCGGCGCUGAGAUCAGACCCGUGGAACCUGCUCCAGCUCGCACUGGCGAAGGGAUGUCCCUGAUGAGCUCC
RS 2 dot …(((.((…..)).)))((((((.((((.((.(((.((…))…))).))))))…..)))))).((((….))))……….
RS 3 seq AGGAAACCGUGGGGGUGCUCAUUCUGGGCUGAGAAAAUACCCCUCGAACCUGAUCGGGUAAUUCCGGCGCAGGGAACGGGUGAGUUUACAGC
RS 3 dot …..(((…..)))((((((((((.((((.(((..(((((.(((….)))..))))).))))))).))))……))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table