Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA025105 Similarity: 0.962 Similarity: 0.959 Similarity: 0.955
UTR: 5HSAA025105
Gene: CREB1
MFE: -57.804
ENS: 0.830
Length: 171.
Predicted Ligands:
TPP - 10/20
Mg2+ - 4/20
cobalamin - 3/20
 RS: URS0002312549_1321781
MFE: -52.557
Ligand: cobalamin
Species: Mitsuokella sp. oral taxon 131 str. W9106 Cobalamin riboswitch
 RS: URS0000BF4933_694068
MFE: -52.450
Ligand: TPP
Species: Fomitiporia mediterranea MF3/22 TPP riboswitch (THI element)
 RS: URS0000D7DC93_1834178
MFE: -36.926
Ligand: Mg2+
Species: Enterococcus sp. 3H8_DIV0648 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA025105 URS0002312549_1321781 URS0000BF4933_694068 URS0000D7DC93_1834178
Length 171. 172. 173. 170.
Similarity - 0.962 0.959 0.955
Ensemble Norm 0.830 - - -
MFE -57.804 -52.557 -52.450 -36.926
Ligands - cobalamin TPP Mg2+
Gene CREB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.004 1.003 11.005
Length SE - 1. 4. 1.
Lev Distance - 48. 49. 53.
UBS 12. 13. 12. 11.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 5.
ILR 3. 4. 3. 5.
H 2. 3. 2. 2.
BL 5. 5. 4. 4.
BR 4. 3. 4. 3.
UN 0.041 0.105 0.092 0.112

Sequences

Field Description
UTR seq + 25 agaccacuccucccggcgccgggcucagcccgccuucgccuucccucuccccgcgguguguuacgugggggagagaauaaaacuccagcgagauccgggccgugaacgaaagcagugacggaggagcuuguaccaccgguaacuaaATGACCATGGAATCTGGAGCCGAGA
UTR dot + 25 ……(((((((((((.((((((((.((………..(((.(((.(((((((……..)))))))))).)))……….))))).)))))))))……………..)))))))((((…(.((((…(((……..)))…)))).).)))).
RS 1 seq AUACAAAUUAGCAGGUUCGGUGCCCCUCGGGGCGUAACAGGGAAAUCGGUGCAAUGCCGAUGCGGUCCCGCCGCCGUAAUGCUGAGGAUGCCCGAAUAUGUCACUGGGAGACUGGGAAGGCAGGGCAACGAUGAAGCAGAGCCGGAAGACCUACCGAAUCUUGUACGUCGGA
RS 1 dot …………..((((((.((.((((((((((…(.((((.((((((…..))))))….))))).))))……))))))..)))))))).((((.(((…………..))))))).(((((..(((((..(((……..)))..))).)).)))))..
RS 2 seq CUUUAUGGCUGCGGGUAUCCGGUUGUAAUGGCACUGCUUCUUGUUUUCCCCUGCUGGAUGUAUGUAGCACAUCUGGCUUUGUGAGCACAGCAGUUCCUUGCACUGGGUUGAGAUUAUACCGCUAGAACCUGAUCAGUGCUCAGACCUGCGUAGGGAAGCCCCCAGUGUCGUCG
RS 2 dot …….(((((((((((((((.(((((.((.((((((…(((((.(….(((((((((…….)))))))))…).))))).)))))).)))))))))))))………………)))))..))))…..((((((….(((….)))))).)))….
RS 3 seq NNNNNNNNNUGUUAGGUGAGGCUCCUAUACAAACAUAGGCUACUGCCCAAAAAUGUCGAGAGACGCCAAUGGGUAGAACAGGAAUUGUCGAAUACAAGGCUUUUCUUAAGGUAGCUAAGAUGUUUGUCUUUACGUUGUAUAGUGCCAAAACUCAACGAUUAGAUCGACUA
RS 3 dot ……..((.(((((.((((((………(((….((.(((((((….((((….))))….)))))))…))….)))………)))))).))))).))………(((.((((…(((((…(((……))))))))…)))).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table