Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA025378 Similarity: 0.954 Similarity: 0.953 Similarity: 0.951
UTR: 5HSAA025378
Gene: CROT
MFE: -20.459
ENS: 0.833
Length: 171.
Predicted Ligands:
lysine - 9/20
glucosamine - 6/20
cobalamin - 2/20
 RS: URS000232B5EB_61635
MFE: -37.254
Ligand: cobalamin
Species: Acholeplasma brassicae Cobalamin riboswitch
 RS: URS0000C7DBEE_1460639
MFE: -50.114
Ligand: Mn2+
Species: Bacillus sp. JCM 19045 yybP-ykoY manganese riboswitch
 RS: URS0000DA026C_1965603
MFE: -39.497
Ligand: lysine
Species: Blautia sp. An249 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA025378 URS000232B5EB_61635 URS0000C7DBEE_1460639 URS0000DA026C_1965603
Length 171. 171. 171. 173.
Similarity - 0.954 0.953 0.951
Ensemble Norm 0.833 - - -
MFE -20.459 -37.254 -50.114 -39.497
Ligands - cobalamin Mn2+ lysine
Gene CROT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.009 4.029 18.043
Length SE - 0. 0. 4.
Lev Distance - 59. 62. 54.
UBS 6. 8. 7. 9.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 0. 0. 1. 0.
H 5. 7. 5. 5.
BL 1. 1. 1. 3.
BR 1. 0. 0. 3.
UN 0.398 0.304 0.228 0.191

Sequences

Field Description
UTR seq + 25 auugaaacuauuaaagaaguagacgagauuaccaagggagaaacuuauaagaggagcuuggaaaggccagugacagaaauuugggaaaagacacauucagcaguguaaggagaacaaauggucaaugaaaaagacuucagugacguATGGAAAATCAATTGGCTAAATCAA
UTR dot + 25 …….(((((…..)))))………(((((………………..)))))…..((((……….))))……((((……..))))…………..((((.((((……)))).))))………………………
RS 1 seq UUAACUUAAUGGGUAUUAGGUGUCUUAGGACAUAACAGGGAAGAAAGUAAAAGCUUUCGCUGCCCCAGCAACCGUAAAACGGACAAAUCACAUAAGCCACUGCGACUAAGCGGGAAGGCGUGAGGCGGAUGAUGUCUUAGCCGGUAGACCUACCUUUUAUCUACUUUUGUA
RS 1 dot …(((((((….)))))))…………………((((((….))))))((((…))))..((((…))))……………..((((……))))…(((.(((((((…..))))))))))((((((………..))))))……
RS 2 seq CAUUCCUUCAAAGGGGAGUAGCUGCAAGUUUAAACACUUGAACCAAAGUCGUCAUUACGUGGAUACUAUCCACCGGCUUUGUUUGGCAUGAUACAUACUAUGUCUAGCAAGACCUUUGCCUCGUUUUCAAAACCAAGGCAGAGGUCUUUUUUAUGUUCUCUCUUCCUCGCU
RS 2 dot .(((((((….)))))))……..((((((….))))))((((((((…….((((((…))))))))))))))…((((((……..))))))….(((((((((((((.((((…))))..)))))))))))))…………………..
RS 3 seq GGGAAAGAUAGAGGAUGCGUUUUUUAUCAGUAGACGGCUGGAUAUGCAGGGAUAGGAGAAGGCCGGUGAAAGGAAAAAACGCCGAAAGGAUAAGACUCCUGCGGUUUUAUUGCUUGGGCAUACAGUGAAGAACUGUAUGACUGUCAUCAAAACGAUGGUGCGCUAUCUGAAGG
RS 3 dot ……(((((((((….)))))))))……(((((…………………)))))….(((.((.(((.((((..((((……)))).))))))).)).)))…((((((((…..))))))))((((((……..))))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table