Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA025433 Similarity: 0.984 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA025433
Gene: CRYBG3
MFE: -31.060
ENS: 0.844
Length: 89.
Predicted Ligands:
TPP - 10/20
glycine - 6/20
cobalamin - 2/20
 RS: URS0000AB2A3D_1696175
MFE: -15.474
Ligand: TPP
Species: Pelagibacteraceae bacterium GOM-A3 TPP riboswitch (THI element)
 RS: URS0000AB9243_693746
MFE: -18.749
Ligand: glycine
Species: Oscillibacter valericigenes Sjm18-20 Glycine riboswitch
 RS: URS0000D91CF1_454136
MFE: -20.397
Ligand: fluoride
Species: Phormidium ambiguum IAM M-71 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA025433 URS0000AB2A3D_1696175 URS0000AB9243_693746 URS0000D91CF1_454136
Length 89. 87. 89. 89.
Similarity - 0.984 0.983 0.982
Ensemble Norm 0.844 - - -
MFE -31.060 -15.474 -18.749 -20.397
Ligands - TPP glycine fluoride
Gene CRYBG3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 3. 6.006
Length SE - 4. 0. 0.
Lev Distance - 17. 22. 22.
UBS 6. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 2. 2. 1. 2.
H 3. 3. 3. 3.
BL 2. 2. 1. 0.
BR 1. 1. 2. 0.
UN 0.258 0.276 0.247 0.180

Sequences

Field Description
UTR seq + 25 auauuucaggggauaugaauccccuacauuaaguaaggauuaugagggcuacccagccccagcaATGTCCAGCGGCCGCAGAAGGGGCA
UTR dot + 25 …….(((((((….)))))))………..((((..((.(((((….)))))…))..))))….(((.(….).))).
RS 1 seq AAUUACUUUAUGGGGUGCCAUAUAGGCUGAGAUAUACCCGUUGAACCUGUCCGGUAAUUCAGAAAGGGAAGAAUGGAUAACAUAAAU
RS 1 dot …..((.(((((….))))).))………..(((.(((((((…..)))…))))…)))….(((…..)))….
RS 2 seq UGAUGGAACUCUGGAGAAUCUCAGAAAUGAGUGCCGAAGGUGCAAGGCUAUAAGCCGAAACUCUCAGGCAAAAGGACAGAGCAAGCUGA
RS 2 dot ………(((((……)))))……((((((.(((….((((…))))…))).)).))))……(((……))).
RS 3 seq AAUAAAGAUGGCGAUGGAGCUCGCCAAAACCGCCUUUGAUUAUUGAAUUAAUUCAUAAAAUCUAAAAGGCUGAUGGCUCCUACUAUUCC
RS 3 dot ……..((((((……))))))…..((((((((((..((((….))))…))))..)))))).(((((……)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table