Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA025436 Similarity: 0.990 Similarity: 0.990 Similarity: 0.988
UTR: 5HSAA025436
Gene: CRYGA
MFE: -8.052
ENS: 0.926
Length: 42.
Predicted Ligands:
preQ_1 - 16/20
SAM - 4/20

RS: URS00021EDED0_12908
MFE: -11.950
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
RS: URS0000C866FA_1565991
MFE: -7.631
Ligand: preQ_1
Species: Bacillus sp. X1(2014) PreQ1 riboswitch
RS: URS00021EDB54_12908
MFE: -11.684
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA025436 URS00021EDED0_12908 URS0000C866FA_1565991 URS00021EDB54_12908
Length 42. 42. 43. 43.
Similarity - 0.990 0.990 0.988
Ensemble Norm 0.926 - - -
MFE -8.052 -11.950 -7.631 -11.684
Ligands - SAM preQ_1 SAM
Gene CRYGA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 3.089 4.004
Length SE - 0. 1. 1.
Lev Distance - 12. 12. 14.
UBS 3. 3. 2. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 0. 1. 0. 1.
H 2. 2. 1. 2.
BL 1. 0. 1. 0.
BR 1. 0. 0. 0.
UN 0.190 0.143 0.488 0.256

Sequences

Field Description
UTR seq + 25 acccucugucaacaaccATGGGGAAGATCACCTTCTACGAGG
UTR dot + 25 .((((.((……..)).))))…….((((….))))
RS 1 seq GCCACAACGGCUUCCUGGCGUGGCAAUUUUUCUAAUGGAGCG
RS 1 dot (((((..(((….)))..)))))….((((….))))..
RS 2 seq GCGGGAGAGGUUCUAGCUACCCUCUAUAAAAAACUAAGGAAAA
RS 2 dot …((((.(((…….)))))))………………
RS 3 seq GCCACAACGGCUUCCUGACGUGGCAGAAAACCCUACCGGAGCA
RS 3 dot (((((..(((….)))..)))))…….((….))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table