Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA025449 Similarity: 0.975 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA025449
Gene: CRYM
MFE: -31.162
ENS: 0.830
Length: 110.
Predicted Ligands:
TPP - 9/20
glycine - 6/20
GMP - 2/20
 RS: URS0000D66ED1_12908
MFE: -55.499
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GCG riboswitch
 RS: URS0000C060DA_316
MFE: -30.967
Ligand: glycine
Species: Pseudomonas stutzeri Glycine riboswitch
 RS: URS0000C05555_1262851
MFE: -43.740
Ligand: TPP
Species: Collinsella sp. CAG:289 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA025449 URS0000D66ED1_12908 URS0000C060DA_316 URS0000C05555_1262851
Length 110. 109. 110. 111.
Similarity - 0.975 0.974 0.973
Ensemble Norm 0.830 - - -
MFE -31.162 -55.499 -30.967 -43.740
Ligands - GMP glycine TPP
Gene CRYM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 10.004 5.
Length SE - 1. 0. 1.
Lev Distance - 29. 30. 32.
UBS 12. 11. 11. 11.
BS 0. 0. 0. 0.
ILL 4. 3. 2. 2.
ILR 3. 2. 3. 3.
H 2. 2. 2. 2.
BL 4. 6. 5. 4.
BR 6. 6. 4. 6.
UN 0.064 0.046 0.127 0.072

Sequences

Field Description
UTR seq + 25 agcagcgggcgcgcucauaaagggcacagccgaggguacguggaucgcggugcggagacugagguuagaaggcacagguggcgagATGAGCCGGGTACCAGCGTTCCTGA
UTR dot + 25 …..(((..(.((((…..)))).)..)))((((.((((((..(.((((((.(…(((..(((….))).))).).))…….)))).)..))).)))))))..
RS 1 seq CUGCCGCCGGGACGCAGUGAUCCUCGCAGGGUCGCACGGUCGCCUCGGGUCGGCCUCGUGUCGGCUCGACCUGCGAGGGGAGCGAGUGGCGAGCCCGACCCGGGUGUCC
RS 1 dot ..((((..(.(((.(.((((…)))).).))).).))))((((.((((((((.(((((..(.((((..(((…))).))))..)..))))).))))))))))))…
RS 2 seq UGUUGACUCUGAAGAGCCGCCGGGCCGUCGUCGCCCGCCGCACCGAAGGAGCAAGCGAACGCCGCAUAGGCUGCUCGUGAAACUCUCAGGUCCAGAACAGAGGGGGCGCU
RS 2 dot ……….((.(.(((….)))).))..(((((.((.((((…((((…((((.((((…..))).).))))….))))..)))……..).)))))))..
RS 3 seq GAUUCGAUGCAGGGGUGCCGCCGCGUGCGCGCGAGCAGGCUGAGAGGGCAUGCGCCCAACCCUUUGAACCUGUCAGUUAACGUUGGCGUAGGGAGCAUGUCCUCAUGGUUU
RS 3 dot ……..((..(.((((((…)).)))).)..))((((((.((((((((((.(((.((((..(((((……)))..))..)).)).))).)))))))))).))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table