Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA025799 Similarity: 0.984 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA025799
Gene: CSN3
MFE: -16.866
ENS: 0.955
Length: 83.
Predicted Ligands:
cyclic-di-GMP - 9/20
zmp-ztp - 4/20
SAM - 3/20
RS: URS0000C5A92E_1423750
MFE: -11.971
Ligand: SAM
Species: Lactobacillus ghanensis DSM 18630 SMK box translational riboswitch (SAM-III)
RS: URS0000C1207E_1473
MFE: -18.097
Ligand: cyclic-di-GMP
Species: Virgibacillus pantothenticus Cyclic di-GMP-II riboswitch
RS: URS0000C83EF4_748449
MFE: -19.926
Ligand: cyclic-di-GMP
Species: Halobacteroides halobius DSM 5150 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA025799 URS0000C5A92E_1423750 URS0000C1207E_1473 URS0000C83EF4_748449
Length 83. 83. 84. 83.
Similarity - 0.984 0.982 0.982
Ensemble Norm 0.955 - - -
MFE -16.866 -11.971 -18.097 -19.926
Ligands - SAM cyclic-di-GMP cyclic-di-GMP
Gene CSN3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 6.001 4.002
Length SE - 0. 1. 0.
Lev Distance - 21. 21. 23.
UBS 7. 7. 7. 6.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 2.
ILR 3. 3. 2. 2.
H 2. 2. 2. 2.
BL 1. 1. 2. 1.
BR 1. 2. 3. 2.
UN 0.108 0.072 0.143 0.060

Sequences

Field Description
UTR seq + 25 caggccaacucaaccuacugccaaccaagaccugacuggcacgaggaaaggugcaauaATGAAGAGTTTTCTTCTAGTTGTCA
UTR dot + 25 …….(((…(((.((((((..((…..))..))))).))))…)))(((((…(((((….)))))..)))))..
RS 1 seq AAAUGUUACAGCACAUUCCCGAGAGGAUUCAUUUUAUGUGAAGCUGCCUUGUAACCAAAUUUUUGAAUGGGGGAAUUUUUGUG
RS 1 dot ….(((((((((..(((.((((((……)))).)).)))..)))..))))))((((..(((……..)))..))))..
RS 2 seq UUUUUAUGAGGGAGCAAAGAUGUGCGAUAAUAUGUGGGCACCUUAAAUCGCAUGGAGCUAGUGGUGCAACCGACCUCUACGUAA
RS 2 dot ……(((((..((..(.((((……)))).)..)).)))))….((.(((((….((((…))))..))))).))..
RS 3 seq AAUAAUUUAGGAACGAUGAAGUAUAACUCAUAUUUGGUCACCUAGGUUAUAUGGAGUUAAUGGUGAAACCGUCCUAUAUUCUU
RS 3 dot .((((((((((…(((.((((((…..)))))).))).))))))))))..(((..(((((((…)))))..))..)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table