Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA026026 Similarity: 0.981 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA026026
Gene: CT45A3
MFE: -22.606
ENS: 0.935
Length: 86.
Predicted Ligands:
glycine - 11/20
guanidine - 2/20
zmp-ztp - 2/20
 RS: URS0000D8E604_474952
MFE: -23.176
Ligand: glycine
Species: Granulicella rosea Glycine riboswitch
 RS: URS0000D9C014_1739315
MFE: -17.285
Ligand: glycine
Species: Globicatella sp. HMSC072A10 Glycine riboswitch
 RS: URS0000B35383_1183432
MFE: -24.647
Ligand: glycine
Species: Agrobacterium genomosp. 3 str. CFBP 6623 Glycine
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA026026 URS0000D8E604_474952 URS0000D9C014_1739315 URS0000B35383_1183432
Length 86. 86. 87. 85.
Similarity - 0.981 0.979 0.979
Ensemble Norm 0.935 - - -
MFE -22.606 -23.176 -17.285 -24.647
Ligands - glycine glycine glycine
Gene CT45A3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 7. 7.014
Length SE - 0. 1. 1.
Lev Distance - 24. 25. 25.
UBS 5. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 2. 2. 4. 1.
H 2. 1. 1. 4.
BL 1. 3. 0. 1.
BR 1. 1. 0. 1.
UN 0.023 0.047 0.011 0.141

Sequences

Field Description
UTR seq + 25 gccauuuugugaggugccgccgucucuccuccagcaaggucaggacuucaggacugaaacaATGACCGATAAAACAGAGAAGGTGG
UTR dot + 25 ..(((((….)))))(((((.(((((……….(((((….((((….))))….)))))……..))))).)))))
RS 1 seq AACGCUAUCGCGGGAGAGAUCGACCAGUCGACGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCAAAAGGACCGCGUUAGCGAA
RS 1 dot ..(((((.((((((((((.(((…………….((.((….)))))))…)))))………..))))).)))))..
RS 2 seq UGACGGAACUCUGGAGAGACCAUUAAUUUGGCGCCGAAGGGGCAAGGCUUUGCUCAAUCUCUCAGGCAAAAGGACAGAGAAAUUGUU
RS 2 dot .(((((..(((((((((((……….((((((…..)))…)))……..))))))………..)))))…)))))
RS 3 seq GAACUCUGGAGAGAAGCCACCUUGAUCUAAAGGACGGCUCGCCGAAGGGAUAACAAUCUCAGGCGACAAGGACAGAGGGGGCUCU
RS 3 dot ….(((….))).(((.((((……))))..)))(((((…(((((….))))).)))))…….((((….))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table