Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA026033 Similarity: 0.980 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA026033
Gene: CT45A6
MFE: -28.958
ENS: 0.951
Length: 102.
Predicted Ligands:
TPP - 15/20
purine - 4/20
Mg2+ - 1/20
 RS: URS0000ABB252_167539
MFE: -22.701
Ligand: TPP
Species: Prochlorococcus marinus subsp. marinus str. CCMP1375 TPP riboswitch (THI element)
 RS: URS0000BEF16E_1750719
MFE: -17.622
Ligand: purine
Species: Kurthia sp. 11kri321 Purine riboswitch
 RS: URS0000C411D6_1685382
MFE: -33.608
Ligand: TPP
Species: Ponticoccus sp. SJ5A-1 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA026033 URS0000ABB252_167539 URS0000BEF16E_1750719 URS0000C411D6_1685382
Length 102. 103. 102. 101.
Similarity - 0.980 0.980 0.979
Ensemble Norm 0.951 - - -
MFE -28.958 -22.701 -17.622 -33.608
Ligands - TPP purine TPP
Gene CT45A6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 4.001 7.
Length SE - 1. 0. 1.
Lev Distance - 23. 26. 25.
UBS 6. 7. 5. 7.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 4.
ILR 2. 3. 1. 2.
H 2. 2. 2. 2.
BL 2. 0. 1. 1.
BR 1. 2. 1. 2.
UN 0.059 0.049 0.088 0.059

Sequences

Field Description
UTR seq + 25 gcgccacaacuucacugccauuuugugaggugccgccgucucuccuccagcaaggucaggacuucaggacugaaacaATGACCGATAAAACAGAGAAGGTGG
UTR dot + 25 ……(.(((((((………))))))))(((((.(((((……….(((((….((((….))))….)))))……..))))).)))))
RS 1 seq AAAUAUCACUAGGGGUGCCUACAAGCUAUUGCUUUUGGCUGAGAUCACACCCUCUGAACCUGAUUCGGUUUAUACCGUCGAAGGAAAGUGAAAGAGAGUGAUC
RS 1 dot …..(((((((((((((……))….)))))))).)))((((((…((((…(((….((((….))))….)))……..)))).))))))
RS 2 seq GUAUAAUAAUUGAAUUACCCUCAUAUAUGUUCGAUAAUAUGGUUCGAAUGUCUCUACCGAGUUGCCGUAAAUAACUUGACUAUGAAGGUGGAUGAACGGUAU
RS 2 dot ……..(((((((………….))))))).((((.(((((……((((((((((((…….))))))………))))))))))).))))
RS 3 seq AGGCGUCUGUUGGGGUGCCCCUCGGGGCUGAGAUGCGGCGACGCAAACCCAUUGAACCUGAACCGGUUAGGACCGGCGUAGGAAACAGCCCUUGCGACCGC
RS 3 dot .(((.((((..(((….))).)))))))…..((((…(((((……….((((..(((((….)))))..))))………))))).))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table