Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA026120 Similarity: 0.958 Similarity: 0.955 Similarity: 0.954
UTR: 5HSAA026120
Gene: CTDP1
MFE: -71.870
ENS: 0.712
Length: 172.
Predicted Ligands:
cobalamin - 16/20
SAM - 1/20
lysine - 1/20
 RS: URS0000D40A82_2043165
MFE: -63.004
Ligand: cobalamin
Species: Candidatus Sulfopaludibacter sp. SbA4 Cobalamin
 RS: URS0002316364_1797576
MFE: -49.542
Ligand: cobalamin
Species: Caldithrix sp. RBG_13_44_9 Cobalamin riboswitch
 RS: URS000231F1D0_546271
MFE: -48.489
Ligand: cobalamin
Species: Selenomonas sputigena ATCC 35185 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA026120 URS0000D40A82_2043165 URS0002316364_1797576 URS000231F1D0_546271
Length 172. 172. 173. 172.
Similarity - 0.958 0.955 0.954
Ensemble Norm 0.712 - - -
MFE -71.870 -63.004 -49.542 -48.489
Ligands - cobalamin cobalamin cobalamin
Gene CTDP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.001 8.003 13.
Length SE - 0. 1. 0.
Lev Distance - 50. 54. 54.
UBS 13. 12. 14. 11.
BS 0. 0. 0. 0.
ILL 5. 5. 3. 3.
ILR 6. 5. 5. 6.
H 3. 3. 4. 3.
BL 5. 2. 6. 4.
BR 3. 2. 3. 1.
UN 0.093 0.116 0.035 0.099

Sequences

Field Description
UTR seq + 25 ggaagucggcgcgggcuaggcgacggguggaagccgguaccgagaggaacuacagcgucgccgccuggguugugucgccgcgguaggcgcugcgcucugagcgcagcgcaggccccguaccgaccgcccgcccgcccucuguccgcgATGAAAGGCCTGTGTGCTGAATGTG
UTR dot + 25 ……((((.(((((..(((((((.((((…((……….))..))))..)))))))))))).)))).((((.((.(((..((((((((((…))))))))))..))).))…)))).((.(((..(((….(((…)))….)))..))).))……..
RS 1 seq GGAAGUCGAAAUUCCGCUGGUGUACGGGAAGCCGGUGAAAGUCCGGCACAGCCCCGCUACUGUAAGCGCGGAGGGCCGAUCGAAAGCGCCACUGUUCCGGCGACGGGAUGGGAAGGCCGAUCGGUUCGAAGAUGCGCAAGUCAGGAGACCGGCCGGCGUGAUUCGUUCAGCU
RS 1 dot …………(((((((..(((((((..(((((…….)))))…..)))).)))..))…)))))((((((((((…..(((.((((((((….))))))))…)))))))))))))(((..(((((..(((.((…)))))..))))).)))……..
RS 2 seq AUCUUUUUUCAUUAUUCUGGUAUCGGGAAGCGCGGUGAAAUGCCGCCACUGCCCCGCAACUGUAAUGGAGAACCAAAACUCAGCAUGCCACUGUCCCAAAACGGAUGGGAUGGGAAGGCGAGUUAGUAGGAUGAUCCCAGAGUCAGGAUACCGGCCAGGAUAGAGUGAACCCG
RS 2 dot ….(((((((((((…(((..((((.((.(((((…..)))))..))..))))..))))))))))))))((…(((.(((.((((.((((((((…….))))))))…)))).)))))).))..(((((……..)))).)(((.((……..))…)))
RS 3 seq UUCAUAUUUUGCCGAUCGGGUGCGCAUAGCGCUCAAUAGAGAAGCAGGUGAAAGACCUGUGCUGUCCCGCAGCUGUAAUGCAGAGUCGACCUCAUGAUGCCACUGGGAAACUGGGAAGGCGAGGAAGAUGAGGAUGCAGAGCCAGAAGAACUGCCCGCUCGGAGCGCUGUUA
RS 3 dot …..(((((((….(((.((((.(((((………….((((((…..)))))))))))..)))).)))….)))))))…((((((..((((.((((….))))…))))……))))))..((.(((((((…..)))…))))…))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table