Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA026298 Similarity: 0.978 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA026298
Gene: CTNNBL1
MFE: -19.855
ENS: 0.745
Length: 101.
Predicted Ligands:
TPP - 14/20
purine - 1/20
fluoride - 1/20
 RS: URS0000ABA13E_478749
MFE: -26.875
Ligand: TPP
Species: Marvinbryantia formatexigens DSM 14469 TPP riboswitch (THI element)
 RS: URS0000BF752C_580166
MFE: -33.515
Ligand: TPP
Species: Rhodospirillaceae bacterium MC2UP-L3 TPP riboswitch (THI element)
 RS: URS0000ABC25F_712938
MFE: -32.303
Ligand: TPP
Species: Lactobacillus fermentum CECT 5716 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA026298 URS0000ABA13E_478749 URS0000BF752C_580166 URS0000ABC25F_712938
Length 101. 101. 102. 101.
Similarity - 0.978 0.977 0.976
Ensemble Norm 0.745 - - -
MFE -19.855 -26.875 -33.515 -32.303
Ligands - TPP TPP TPP
Gene CTNNBL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 10. 4.017
Length SE - 0. 1. 0.
Lev Distance - 29. 26. 31.
UBS 9. 9. 11. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 1.
ILR 1. 2. 3. 2.
H 2. 2. 2. 2.
BL 4. 3. 4. 5.
BR 4. 3. 3. 5.
UN 0.010 0.059 0.029 0.139

Sequences

Field Description
UTR seq + 25 ggcaugcagcgugaaugcaaaguaguucuguucuuagugccugggcauagguuuguugaaagguucagguauagaaATGCGTCGGAAACAAACTGGTACTC
UTR dot + 25 (((((..((((.((((……..))))))))….))))).(((.((.((((((((……((((.((((….)))).).))))))))))).)).)))
RS 1 seq UUUUUAUGCUAGGGGAGCCUUUGGCUGAGAAAGCACUGCGGUGCUGACCCUCACUACUUGAACCGGGUAAUACCGGCGUAAGGAAGCAGACUACCGAAGAA
RS 1 dot ((((((.(((((((….)))))))))))))….((.((((((((…….((.((((..((((……))))..))))..))))).).)))).))..
RS 2 seq CGCCUUCCUCGGGGGAGCCUGACGGCUGAGAGGUUGCGCGACGCAACGACCCCAGAACCUGAUCCCGCUAGUACGGGCGUAGGGAGAGGCGAUGCCGGCAAA
RS 2 dot .((((((((((((….))))).))….)))))(((.((..(((.((.((.(….((((..((((……))))..))))..).)))).))))))))..
RS 3 seq AAUAGUUGCUAGGGGUGUCGGACCACCGACUGAGACGCCAAUUGGCGGACCCUUUGAACCUGGGAGUUUGGACUCGCGGAGGGAAGCAACGGUCGGCGAAA
RS 3 dot ………..((.((.((((……..)))).)).))..((.((.((((((((….(((.((((….)))).)))…))))….)))).)).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table