Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA026336 Similarity: 0.975 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA026336
Gene: CTNND2
MFE: -27.946
ENS: 0.903
Length: 109.
Predicted Ligands:
methionine - 12/20
SAM - 4/20
TPP - 2/20
 RS: URS0000AB3999_762948
MFE: -35.833
Ligand: methionine
Species: Rothia dentocariosa ATCC 17931 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C520C3_1678130
MFE: -48.779
Ligand: TPP
Species: Modestobacter sp. VKM Ac-2676 TPP riboswitch (THI element)
 RS: URS0000C03879_1736503
MFE: -39.693
Ligand: methionine
Species: Streptomyces sp. Root264 S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA026336 URS0000AB3999_762948 URS0000C520C3_1678130 URS0000C03879_1736503
Length 109. 110. 109. 109.
Similarity - 0.975 0.974 0.973
Ensemble Norm 0.903 - - -
MFE -27.946 -35.833 -48.779 -39.693
Ligands - methionine TPP methionine
Gene CTNND2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.001 5.005 7.014
Length SE - 1. 0. 0.
Lev Distance - 32. 33. 33.
UBS 8. 8. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 0. 0. 0. 1.
H 4. 4. 4. 5.
BL 3. 3. 4. 3.
BR 4. 3. 4. 3.
UN 0.147 0.182 0.073 0.028

Sequences

Field Description
UTR seq + 25 aaagcgccgccugaaagccagguuuggaaggcugugcguguguaugggagaugagcgaugcaaaauuggggugauccguaauuaATGAGCAGCATGAGTTCAGCAGAAG
UTR dot + 25 …((((.((((…..(((….))).)))).))))…(((((.(……..).))))).(((((.((….)).)))))..(((((…….)))))…….
RS 1 seq GAUUAUGAGUCCCGGCGUAAAGCUCUGGCUAGCCGGGCGGCAACCCUCUCCCGUAGCGGGGUGCCCCAGAUGAUGAUCUGGCUUCAAGGGAUACGAAGCAAGUACGGCGC
RS 1 dot ……..(.((((((….(((….))).)))))))((((.(((.((…..)).))).)))).(((((….)))))(((((………)))))………..
RS 2 seq UGCGCUGCACACGGGAGCCCGGGCGCGGCGUGAGACGGCGGACGACCACCGCCGACCGUUCAACCUGAUCCGGUUCGUACCGGCGGAGGGAGCUGCCCGAUGCUCGCUG
RS 2 dot .(((((((.(.(((….))).).)))))))..((((((((.((…..))))).)))))….(((..(((((….))))))))((.((((……..)))).)).
RS 3 seq GGUCAUGAGCGUCAGCGACAAGCCCUGGCUUGCUGACCGGCAACCCUCCCACCGCGGUGGGGUGCCCCAGGUGACGACCCGGCCGAUGAAGUUUCGGUAAGCGCGAGGC
RS 3 dot ((((((((((….((…..))….))))).)))))(((.(((((.((…..)).))))))))((.(((….))).))((((…….))))…((…..))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table