Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA026538 Similarity: 0.954 Similarity: 0.954 Similarity: 0.954
UTR: 5HSAA026538
Gene: CTSD
MFE: -63.175
ENS: 0.878
Length: 158.
Predicted Ligands:
FMN - 10/20
Mg2+ - 3/20
glucosamine - 2/20
 RS: URS0000D8549E_1898205
MFE: -54.722
Ligand: FMN
Species: Ruminococcaceae bacterium FMN riboswitch (RFN element)
 RS: URS0000C2D06E_463025
MFE: -60.772
Ligand: FMN
Species: Bordetella sp. AU3182 FMN riboswitch (RFN element)
 RS: URS0000ABB63A_903814
MFE: -38.497
Ligand: Mg2+
Species: Eubacterium limosum KIST612 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA026538 URS0000D8549E_1898205 URS0000C2D06E_463025 URS0000ABB63A_903814
Length 158. 158. 156. 159.
Similarity - 0.954 0.954 0.954
Ensemble Norm 0.878 - - -
MFE -63.175 -54.722 -60.772 -38.497
Ligands - FMN FMN Mg2+
Gene CTSD - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 7.002 6.
Length SE - 0. 4. 1.
Lev Distance - 59. 53. 58.
UBS 12. 14. 12. 11.
BS 0. 0. 1. 0.
ILL 3. 2. 1. 3.
ILR 4. 5. 4. 2.
H 3. 3. 4. 4.
BL 3. 3. 4. 3.
BR 4. 4. 4. 4.
UN 0.108 0.108 0.058 0.101

Sequences

Field Description
UTR seq + 25 gcgcacgccggccgcgcccacgugaccgguccgggugcaaacacgcgggucagcugauccggcccaacugcggcgucaucccggcuauaagcgcacggccucggcgacccucuccgacccggccgccgccgccATGCAGCCCTCCAGCCTTCTGCCGC
UTR dot + 25 ..((((.((((((((((….)))..))).))))))))…….((((((….))))))……..((((((…….((((….(((((.(((..(((((.((………..)).)))))..))).))).))…..))))…))))))
RS 1 seq CCGCAUAUCCAAGGCGAGGUGUGAUUCCUCGACCGGCGGUGUUCCAUGAGCGAUAGCUCAUCGGUAAGCCCGCAACUCCCGUCAAAUCUUUUAUCAGGCGGGACUGACACGGUGAGAUCCCGUGGCCGACGGUAAAGUCCGGAUGGAAGGAGUUGUUU
RS 1 dot …………(((((((…….))))).))..(((.(((((((((((….)))))).))..))))))(((((((..(((..(((((((((.(((((((((.((…)).)).))))…)))…))))))….))))))..)))))))…
RS 2 seq GUACGUCUUCAGGGCGGGGUGAAAUUCCCCACCGGCGGUAGGCCAUGCAAAGUGGCAAGCCCGCGAGCGCCCGCGGUCCGGCAACGGUCGGCGGGGUCAGCAGAUCUGGUCAGAUUCCAGAGCCGACGGUCAUAGUCCGGAUGAGAGAAGAUGUGC
RS 2 dot ((((((((((..((.((((…….)))).))…(((..(((((…..)))))..)))((((……))))(((((((.((.(((((((((((((.((….)).)..))))))…)))))).))….).))))))….))))))))))
RS 3 seq UAAAUAUUUCGGUAGGUGAGGCUACCACAGGGAUAUGGAUUACUGCCGCAAACUAGUGGAGACACUACAAGAUGGUCAACAGUUUAUGUCGAACGCAAGGCAUUGACUAAUGUAAUUUCACCGCCCUGUGAAGCUAAAGCUUGAACGGUGAAUAGAUUA
RS 3 dot …((((((((((((……)))))…)))))))……..((((…..(((((….)))))…..))))…..(((.(((((……..))))).)))((((.((..(((((((…..(.((((….)))).).))))))))).))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table