Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA026562 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA026562
Gene: CTSK
MFE: -15.614
ENS: 0.822
Length: 78.
Predicted Ligands:
SAM - 9/20
cobalamin - 7/20
fluoride - 2/20
 RS: URS0000DB1071_1895733
MFE: -21.573
Ligand: SAM
Species: Burkholderiales bacterium 70-64 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000BE1D54_1643450
MFE: -20.931
Ligand: SAM
Species: Devosia sp. H5989 SAM riboswitch (alpha-proteobacteria)
 RS: URS00023300BC_408172
MFE: -17.527
Ligand: cobalamin
Species: marine metagenome AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA026562 URS0000DB1071_1895733 URS0000BE1D54_1643450 URS00023300BC_408172
Length 78. 78. 79. 79.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.822 - - -
MFE -15.614 -21.573 -20.931 -17.527
Ligands - SAM SAM cobalamin
Gene CTSK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 7. 9.
Length SE - 0. 1. 1.
Lev Distance - 22. 20. 20.
UBS 8. 7. 7. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 1. 2. 2. 2.
H 2. 2. 2. 2.
BL 2. 1. 3. 2.
BR 4. 3. 2. 2.
UN 0.154 0.103 0.165 0.165

Sequences

Field Description
UTR seq + 25 acacuuugcugccgaaacgaagccagacaacagauuuccaucagcagguaacgATGTGGGGGCTCAAGGTTCTGCTGC
UTR dot + 25 …((((((((.(……..).))).))).))……..(((((((..((..((.(….).))..))))))))).
RS 1 seq CGGUCUCAUCGCGCCGAUUUGAGGAUCAGCUUGCGGGCGCGUUACAAGUACGGCUAAAGCGGCCAGGUUCACGCCCGA
RS 1 dot .((((((((((…)))..)))).)))……((((((.(..((……((((…..))))..)).).)))))).
RS 2 seq AAACGGCUCGGUGGUGAUUUGGCCGGUCUGAUUGCAGCCACCUAAAACAAGUUGCUAAAGGAACCGUAGGGAGCUGGCC
RS 2 dot ….(((.((((.(…..).)))))))……((((..((((……(((.(….).)))..))))..))))…
RS 3 seq AUACUGAAUCUUGACGGGGAAUUAGUGCGAAAUUCACUUGCUGUUCCUGCAACCGUAUAGUCGGAGUGCCGUCCAGUAU
RS 3 dot .((((((.((((….)))).))))))………..(((((..(..(((.(((……)))..))).)..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table