Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA027204 Similarity: 0.980 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA027204
Gene: CUL3
MFE: -34.144
ENS: 0.999
Length: 93.
Predicted Ligands:
TPP - 6/20
glutamine - 4/20
glycine - 3/20
 RS: URS0000C70A68_183763
MFE: -32.007
Ligand: glycine
Species: Streptomonospora alba Glycine riboswitch
 RS: URS0000DA191D_1895739
MFE: -38.873
Ligand: zmp-ztp
Species: Cellulomonas sp. 73-145 ZMP/ZTP riboswitch
 RS: URS0000C28829_1136941
MFE: -35.012
Ligand: TPP
Species: Gordonia sp. QH-11 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA027204 URS0000C70A68_183763 URS0000DA191D_1895739 URS0000C28829_1136941
Length 93. 92. 92. 94.
Similarity - 0.980 0.979 0.978
Ensemble Norm 0.999 - - -
MFE -34.144 -32.007 -38.873 -35.012
Ligands - glycine zmp-ztp TPP
Gene CUL3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 10. 3.003
Length SE - 1. 1. 1.
Lev Distance - 25. 23. 27.
UBS 7. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 3. 1.
ILR 1. 2. 3. 1.
H 2. 2. 2. 3.
BL 3. 4. 2. 2.
BR 3. 3. 3. 3.
UN 0.075 0.120 0.054 0.021

Sequences

Field Description
UTR seq + 25 agugagauguuuguccgucgccgccgccgccgccaucgcggaggagcgcgauaaaggggacgagcaccATGTCGAATCTGAGCAAAGGCACGG
UTR dot + 25 …….(((((((((((((.(((..((.((((….)))).)).)))))))…..)))))))))((.((((………….)))).))
RS 1 seq CGAUACCACGCGGGAGAGACCCCCAUCAGCGGGGCGCCGACGGGGCAACACUCCCCAGUAACCUCUCAGGCACCAAGGACCGCGUGGAGGAG
RS 1 dot …….((..(((((….((((.((.(((…))).)).))))…..)))))..))..((((.((.((……….)).))))))..
RS 2 seq GGCCUCGGCCGUGACUGGCGAACCGAGGUGGAUCACCACCGGGGAGCGGCCGCACCACCGUCGUCCGUGCACCGUCCGCCUGGGUGCCCGGG
RS 2 dot …..((((.(((..(((((..((..(((((….)))))..))..)).)))…))).))))((((.(((((………))))).))))
RS 3 seq GUGAGUGACACGGGGUGCUGCCGCGGCAGCUGAGACCACACCCGUCGAACCUGAUCCGGUUAGCACCGGCGAAGGGAUGUCCGCCUCCUUCGUC
RS 3 dot (((…..)))..((((((((((.(((((.(..(((…….)))..).))).)))))).))))))(((((((((………)))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table