Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA027288 Similarity: 0.972 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA027288
Gene: CWF19L1
MFE: -36.985
ENS: 0.840
Length: 113.
Predicted Ligands:
TPP - 13/20
guanidine - 2/20
methionine - 2/20
 RS: URS0000C770F8_1262991
MFE: -30.768
Ligand: zmp-ztp
Species: Firmicutes bacterium CAG:882 ZMP/ZTP riboswitch
 RS: URS0000C5A426_1666917
MFE: -35.655
Ligand: guanidine
Species: Rhodobacteraceae bacterium HLUCCO18 Guanidine-I riboswitch
 RS: URS0000BFBE7F_1404245
MFE: -39.971
Ligand: TPP
Species: Corynebacterium glyciniphilum AJ 3170 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA027288 URS0000C770F8_1262991 URS0000C5A426_1666917 URS0000BFBE7F_1404245
Length 113. 113. 113. 114.
Similarity - 0.972 0.972 0.972
Ensemble Norm 0.840 - - -
MFE -36.985 -30.768 -35.655 -39.971
Ligands - zmp-ztp guanidine TPP
Gene CWF19L1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7.002 9.005
Length SE - 0. 0. 1.
Lev Distance - 36. 35. 33.
UBS 9. 9. 10. 9.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 2. 2. 3.
H 3. 2. 3. 2.
BL 4. 3. 5. 2.
BR 4. 4. 2. 4.
UN 0.062 0.088 0.106 0.132

Sequences

Field Description
UTR seq + 25 ugauuguugcgcggucgcauuuuuccggggagcgcggauucgcauucccaauuuuagguggcagucgcaacccauacuauucggacagATGGCACAGAAACCGCTGCGCCTCT
UTR dot + 25 …..(((((((.(((((………(((((.(((….))).)))))……..))))).).))))))((………))..(((.(((.(((……))).))))))
RS 1 seq ACAUAGAAUCACGACUGGCGGAAAGCGGAGGUCGAUUAAUGUAUUGAUUUUCGUGGCAGGAUUACCUGCAGGGAGUGAUUGGUUAAGACAUGCCGACCGCCUGGGCGAUGCUU
RS 1 dot ……((((((..((.((((.((((((((((((((……))))))))))))…….)).)).)).))..))))))….(((.((((((………))).))))))
RS 2 seq GCACAGAGCAUUUAGGGUUCCGCCUUCCGACGCCGUCCGAAGGGUCUGGUCCGAGAAAUGCAGCCGGUCGGCAAAUUCCGCCCGGUCCACGGCGGGCCAAAAUCCCGGGAGAG
RS 2 dot …….((((((.(((..((((((((.(((…))).)))))…))))))…))))))..((((.(((……))).))))(((.(((.((…….))))))))…
RS 3 seq CCCACAGACACGGGGUGUCCCGCCACGCAGCAACUGCGCUGCGCCGGGGCUGAGAUCACACCCGCUGAACCUGACCUCAUUCACAUGAGCGGAGGAAUGUCCUAUGCCGCCCGU
RS 3 dot ….(((.((((((((((((((…((((((……)))))).))))))…….)).)))).))…)))………..(((.((((((((…))))…)))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table