Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA027613 Similarity: 0.957 Similarity: 0.954 Similarity: 0.949
UTR: 5HSAA027613
Gene: CYP19A1
MFE: -42.272
ENS: 0.915
Length: 167.
Predicted Ligands:
Mg2+ - 12/20
FMN - 3/20
cobalamin - 2/20
 RS: URS0000C381A6_931276
MFE: -29.898
Ligand: glycine
Species: Clostridium saccharoperbutylacetonicum ATCC 27021 Glycine riboswitch
 RS: URS0000CEA0D9_1891238
MFE: -72.142
Ligand: TPP
Species: Burkholderiales bacterium TPP
 RS: URS0000AB9003_699246
MFE: -48.758
Ligand: lysine
Species: Clostridiales genomosp. BVAB3 str. UPII9-5 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA027613 URS0000C381A6_931276 URS0000CEA0D9_1891238 URS0000AB9003_699246
Length 167. 168. 167. 168.
Similarity - 0.957 0.954 0.949
Ensemble Norm 0.915 - - -
MFE -42.272 -29.898 -72.142 -48.758
Ligands - glycine TPP lysine
Gene CYP19A1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 9.012 15.011
Length SE - 1. 0. 1.
Lev Distance - 55. 59. 62.
UBS 7. 8. 8. 8.
BS 3. 3. 2. 0.
ILL 1. 2. 1. 2.
ILR 2. 2. 1. 1.
H 3. 3. 4. 4.
BL 1. 2. 3. 2.
BR 2. 3. 3. 1.
UN 0.263 0.214 0.156 0.161

Sequences

Field Description
UTR seq + 25 gggaguuucuggagggcugaacacguggaggcaaacaggaaggugaagaagaacuuauccuaucaggacggaagguccugugcucgggaucuuccagacgucgcgacucuaaauugcccccucugaggucaaggaacacaagATGGTTTTGGAAATGCTGAACCCGA
UTR dot + 25 ….((((((((((((………(((((……((((((((……..)))).)))).((..((((((((((((((….)))))))))))….)))..)))))))…….))))))…….))))))…….(((((.(……).)))))…
RS 1 seq AUGACGAAUUUGGGAGAGACUGCAAAUAAAGCAUUUUAAAGAAAAAAUUGCUUUAGACACAUGAAAAUAGGCUAGCAAGAGGACUUGUUAUUUAUUUGAUAGUGCCAUAUAGCAGCGCCGAAGGUGAAGCCGCAACAAACUCUCAGGCAAAAGGACCGAAUUCUGACG
RS 1 dot …..(((((((((((((..(((…(((((((((((……))))).))))))(.(((….(((((((.(((((((….))))))))))))))….))).)…..((..((((…))))..)).)))…..)))))………..))))))))…..
RS 2 seq UCGUAACGCUAGGGGUCCCGCACAAAUCCGCGACGUUGUCGCGGUCUGGCGAGCAAGCUCCGAAACCUCCCGCAGGAGUUUUCGGAGCUUCCUUUCCGGACGGGUGAGAGAAACCCUUGGAACCUGAUCAAGUUAACUCUUGCGCAGGGAAGCGUAUGCCGGCUUCC
RS 2 dot ……..((((((((((((…….(((((((…)))))))(((((.(((.(((((((((((.((((….)))).))))))))))).))).)))))))))……..))))))))…(((..((((……))))..)))((((((……..))))))
RS 3 seq UCAAUAGGUAGAGGCGCAUUGGUUAAAUAGUAAGCGUACAUUCGAGGUGGGCGACACCGUACGGCGAAAGGUAACCGAUGCCGAAGCAGGAGUCAUCGCCGGGGCUUUUGCUGGUUCGUCAUCAUAAUAGGUGCCGAACUGUCACAUAUGUGGAGAGCUAACCAUUGG
RS 3 dot ………….(.((((((((((………(((((……((((…..)))))))))……..)))))))))))..((((((((((……..))))))))))((((((.((((……)))).))))))………((((……..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table