Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA028160 Similarity: 0.937 Similarity: 0.934 Similarity: 0.934
UTR: 5HSAA028160
Gene: DAZAP2
MFE: -69.240
ENS: 0.956
Length: 209.
Predicted Ligands:
cobalamin - 16/20
unknown - 2/20
glucosamine - 1/20
 RS: URS0000C4CA71_1618520
MFE: -50.289
Ligand: glucosamine
Species: Microgenomates group bacterium GW2011_GWC1_43_11 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS00023296D2_376489
MFE: -76.419
Ligand: cobalamin
Species: Halotalea alkalilenta Cobalamin riboswitch
 RS: URS0000D84580_1920420
MFE: -77.907
Ligand: FMN
Species: Paenibacillus sp. FSL A5-0031 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA028160 URS0000C4CA71_1618520 URS00023296D2_376489 URS0000D84580_1920420
Length 209. 208. 209. 208.
Similarity - 0.937 0.934 0.934
Ensemble Norm 0.956 - - -
MFE -69.240 -50.289 -76.419 -77.907
Ligands - glucosamine cobalamin FMN
Gene DAZAP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 9. 7.
Length SE - 1. 0. 1.
Lev Distance - 81. 83. 83.
UBS 17. 17. 18. 16.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 5.
ILR 3. 4. 5. 2.
H 4. 5. 5. 4.
BL 8. 7. 7. 7.
BR 7. 7. 6. 7.
UN 0. 0.111 0.120 0.111

Sequences

Field Description
UTR seq + 25 cggacccucccgcggccgacuggaggcccggagcaggggcggaguuuccggcggcagcgccacucgggcgucgggugacgcuaggcggacggaccaucaugugacacggaaguagcuccgaacaggaagaggacgaaaaaaauaaccguccgcgacgccgagacaaaccggacccgcaaccaccATGAACAGCAAAGGTCAATATCCAA
UTR dot + 25 .(((…)))(((.((((.(((((((((((………))).)))))))))))).)))…(((.(((((((.(.((((………((..((.((.(((….((((……)))).))).)).).)..))………..))))).))))))))))……..((((.((…………..))…))))………
RS 1 seq AAAACGUAUACAGCGAGUGGCCCACUAUUUUUUACUAAAUAAAAUAGGGGGAUACGAGGAAUGGGUGCCUUCUUUAUUAAGAGGACAAUCGGACUGGUCUUUAUACGACCAAGUAUCUGCGGAAACCCAUCGGUGGCGCUCCCCACCGUAAUUUUUGUGCGAAAACUCCAGUCGUAAGGUUGGAAAUAAAACACAAGAGAUGGAGCCC
RS 1 dot …..((((.((.(..(((.(((.(((((((………))))))).))).)))..)…)).))))((((((….))))))……..(((((((…….))))).))…((((.(((…..((((((……))))))…..))).))))….(((((.((.(..((((……..))).)..).)))))))…
RS 2 seq AGGAUAGGUCCGAUCCAAGGUGCCUCGCCUGCAAGCUCGCGAGGAUAAUCGGGAAAGCGAUGUGAAUUCGCUGCUGUCCCCGCAACGGUGAUCGAGUGCUCCAUGCGAAGCCACUGUCGAGCGUCAAGGCCGACGGGAAGGCGCAUGGCGCGGGUGAGCCAUCUCACCACCUCGUCAGCCCGGAGACCGGCCUUGGGACGAUAACCACG
RS 2 dot ….((.((((..(((..(((.((((((..(….)..))))))…))).)))..).))).))…((((((.(((….))).))))))……((.((((((…(((.((((((.((……))))))))…))))))))).)).((((((….))))))…(((((((.((((…)))).))…)))))……..
RS 3 seq GCAAUCCUUCGGGGUAGGUGAAAUUCCUAACCGGCGGUGAUCGGGAAGGCACAGAAUAUCGGAUAACCGAAUUUCUGUGCCUCUCGUCAGUCCGUGACCCGGUUUAAACGGCAUUUUAUCCAAGAUCAUUUGGAUAGAAUACGAUUAGAACGGUGGACCUGGUGAAACUCCGGGACCGACAGUACAGUCUGGAUGGGAGAAGGGGAUG
RS 3 dot …..((.((((..((((…….)))).)))).))(((.((((.((((((((((..((((….))))..)))))))))))))))))(((((….(((.(((((.((..(((((((((((……))))))))))).)).))))).))))))))………((((.(..(.(((……))).)..).))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table