Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA028162 Similarity: 0.935 Similarity: 0.934 Similarity: 0.932
UTR: 5HSAA028162
Gene: DAZAP2_0
MFE: -77.824
ENS: 0.890
Length: 222.
Predicted Ligands:
cobalamin - 19/20
FMN - 1/20

 RS: URS000231A63F_1080068
MFE: -77.846
Ligand: cobalamin
Species: Leptolyngbya sp. O-77 Cobalamin riboswitch
 RS: URS000231478E_1110502
MFE: -100.794
Ligand: cobalamin
Species: Tistrella mobilis KA081020-065 Cobalamin riboswitch
 RS: URS000232204E_1780376
MFE: -73.032
Ligand: cobalamin
Species: Alistipes sp. CHKCI003 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA028162 URS000231A63F_1080068 URS000231478E_1110502 URS000232204E_1780376
Length 222. 221. 222. 222.
Similarity - 0.935 0.934 0.932
Ensemble Norm 0.890 - - -
MFE -77.824 -77.846 -100.794 -73.032
Ligands - cobalamin cobalamin cobalamin
Gene DAZAP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 6.001 19.001
Length SE - 1. 0. 0.
Lev Distance - 81. 85. 80.
UBS 19. 19. 20. 16.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 4.
ILR 4. 5. 5. 5.
H 4. 5. 4. 4.
BL 9. 8. 11. 7.
BR 8. 6. 8. 6.
UN 0.086 0.072 0.059 0.063

Sequences

Field Description
UTR seq + 25 gggcgggaccgcgcggacccucccgcggccgacuggaggcccggagcaggggcggaguuuccggcggcagcgccacucgggcgucgggugacgcuaggcggacggaccaucaugugacacggaaguagcuccgaacaggaagaggacgaaaaaaauaaccguccgcgacgccgagacaaaccggacccgcaaccaccATGAACAGCAAAGGTCAATATCCAA
UTR dot + 25 (((.(((.((….)).))).)))(((((((.(((((((((((………))).))))))))))))..)))..(((.(((((((.(.((((………((..((.((.(((….((((……)))).))).)).).)..))………..))))).))))))))))……..((((.((…………..))…))))………
RS 1 seq AGCCCGCCGCUCUGCUUCGGUUCUGGUGGGGAUCAGCCACCAGACGCAAGGGGGAAAGUUCGGUGCGAAUCCGACGCUGUCCCGCAACUGUGAUGAGCGCAACCGCGCAGGAUGCUUGACCCUCUGCUUGCCAGGUUCCUUUGGCAGAGCGGAUUUGUCAGUUCUUUAGCCUGAGUGCGUUAUCUCUGAGUCAGGAUGCCCGCCGAUAGCACCACCUGAUG
RS 1 dot …(((..((…))..))).((((((((…….))))))))((((.(.((((.(((((((…….)))).))).)))).)…))))…(((((.((((.((((((.((.((((..(((((((((((((….))))))).))))))…))))))))))..)).)).)))))))……..((((((.(((………)))…)))))).
RS 2 seq UUUAUGGUGCGGGGCGACGGUUCCGUGCCGCCUUUCCCCGGAAAGGAGGCCGGCGAAGAGGGAAUGCGGUGCGGCGCCAGGGCGCCCAGGCCGCGGCUGUACCCGCAACUGUAGGCGGUGAGCCCACCCCCAUGACAGCCACUGGCGGUAACAGGCCGGGAAGGCCGGGGGUCCGGGCCUGGACCCGCGAGCCAGGAGACCUGCCGUCACCACCCCGCGUAU
RS 2 dot ….(((((((((((….)))))))))))(((((.(((((……..)))).).)))))……(((.(((.(((.((((.(((.((((.(((((((..((((..((((.((.((((….)))).))…))))……))))..)))).)))….))))))).)))).)))))).)))((((.(…((.(((…..))).))…)))))…
RS 3 seq GUAUAUUUGCACCGCAAAGGUUCUCCGGCCGCACUCCGCAUAGCAGGAGCCGCGAAUGGGGAUGAAAAGGGAAUGCAGUGAGAAUCUGCGACAAUGCCCGUUGCUGUGUGUUCCGGCCCUGCGGGGCGAAAAAGUUUUACCAUCUGUUGCCACUGGCCCCACGGGCCGGGAAGGCGUAAAACGGGAACGAGUCAGAAGACCUGCCGAUGCGUACCAUAAGAU
RS 3 dot (((….)))(((…..)))((((((..(((.((((……..))))..)))..))))))…….((.(((((.((….(((.((((….((((((..(((((.(((((((((.(.(((((……………………….))))).))))))))))..))))).))))))…..))).).)))…..)).))))).))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table