Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA028192 Similarity: 0.973 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA028192
Gene: DBF4B
MFE: -34.227
ENS: 0.920
Length: 118.
Predicted Ligands:
methionine - 7/20
SAM - 4/20
FMN - 2/20
 RS: URS0000C03E26_909626
MFE: -57.764
Ligand: methionine
Species: Streptomyces sp. RV15 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C67F35_1214242
MFE: -50.964
Ligand: methionine
Species: Streptomyces collinus Tu 365 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C02359_1678012
MFE: -51.864
Ligand: methionine
Species: Streptomyces sp. MUSC 1 S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA028192 URS0000C03E26_909626 URS0000C67F35_1214242 URS0000C02359_1678012
Length 118. 117. 117. 117.
Similarity - 0.973 0.971 0.971
Ensemble Norm 0.920 - - -
MFE -34.227 -57.764 -50.964 -51.864
Ligands - methionine methionine methionine
Gene DBF4B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 18.001 18.001
Length SE - 1. 1. 1.
Lev Distance - 33. 31. 31.
UBS 7. 8. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 1. 2. 3. 3.
BR 1. 3. 4. 4.
UN 0.093 0.068 0.068 0.068

Sequences

Field Description
UTR seq + 25 acuguggaaucgggaagagcucauggagcucgcgaauguaauacggaggccucugaggaaggaguacggaggccgagaaggagccggcauuugATGAGCGAACCGGGAAAGGGAGACG
UTR dot + 25 .((((((..((…..))..)))))).((((((((((((….(((.((((((((………..))))))))………)))))))))).)))))…((……))……
RS 1 seq GGUCAUGAGUGACAGUCAUGAGGCCCCGGCCGACUGUCCGGCAACCCUCCGUCCGUGGCGGGGUGCCCCGGGUGAGGACCAGGCCGUGGGCAGCGAGGUCUGCGGCAAGCGCGGACC
RS 1 dot ..((((((…….)))))).(((((((((….((((((((.(((.((……)).))).))))……..))))..))))).))))…..((((((((…..))))))))
RS 2 seq GGUCAUGAGUGACAGUCAUGAGGCCCCGGCCGACUGUCCGGCAACCCUCCGUCCGUGGCGGGGUGCCCCGGGUGAGGACCAGGUCGUGGGCAGCGAGGUCCACGACAAGCGCGGACC
RS 2 dot ..((((((…….)))))).(((((((((….((((((((.(((.((……)).))).))))……..))))..))))).))))…..(((((.((…..)).)))))
RS 3 seq GGUCAUGAGUGACAGUCAUGAGGCCCCGGCCGACUGUCCGGCAACCCUCCGUCCGUGGCGGGGUGCCCCGGGUGAGGACCAGGUCGUGGGCAGCGAGGUCCACGGCAAGCGCGGACC
RS 3 dot ..((((((…….)))))).(((((((((….((((((((.(((.((……)).))).))))……..))))..))))).))))…..(((((.((…..)).)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table