Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA028453 Similarity: 0.992 Similarity: 0.991 Similarity: 0.990
UTR: 5HSAA028453
Gene: DCTN3
MFE: -23.962
ENS: 0.873
Length: 60.
Predicted Ligands:
unknown - 15/20
fluoride - 3/20
glutamine - 2/20
RS: URS0000C1FE2F_1455638
MFE: -15.805
Ligand: fluoride
Species: Bacillus sp. SA1-12 Fluoride riboswitch
RS: URS0000C52D33_12908
MFE: -11.871
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
RS: URS0000C5333C_12908
MFE: -8.752
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA028453 URS0000C1FE2F_1455638 URS0000C52D33_12908 URS0000C5333C_12908
Length 60. 60. 60. 60.
Similarity - 0.992 0.991 0.990
Ensemble Norm 0.873 - - -
MFE -23.962 -15.805 -11.871 -8.752
Ligands - fluoride glutamine glutamine
Gene DCTN3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 2.010 2.022
Length SE - 0. 0. 0.
Lev Distance - 10. 12. 13.
UBS 3. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 1. 1.
BR 1. 0. 1. 1.
UN 0.133 0.133 0.233 0.283

Sequences

Field Description
UTR seq + 25 ggcuguuuccuggccgaggugggucgguaguagcgATGGCGGGTCTGACTGACTTGCAGC
UTR dot + 25 .((((((..((((((……)))))).))))))….(((((((…..)))))))…
RS 1 seq GUUAACAUAGGUGAUGGAGUUCACCUUUAACCGCCGUUGGCUAAUGACUCCUGCCAGUAA
RS 1 dot (((((…((((((……)))))))))))…..(((((………..)))))…
RS 2 seq AUCGUUCAAUUUGAGACUUUUCUCAAAUCGGAAGUAGGUUUUUAACCGAAGGAACGCAUG
RS 2 dot ….(((.((((((((….)))))))).)))…..((((((……))))))…..
RS 3 seq AUCGUUCAAUUUAAGUAUAUUCUUAAAUCGGAAGUAAGUCUUUGACUGAAGGAACGCAUG
RS 3 dot ….(((.(((((((……))))))).)))……(((((…..)))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table