Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA028474 Similarity: 0.963 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA028474
Gene: DCTN4
MFE: -44.561
ENS: 0.872
Length: 141.
Predicted Ligands:
cobalamin - 8/20
glycine - 3/20
TPP - 3/20
 RS: URS0000C03B3E_1097667
MFE: -67.111
Ligand: cobalamin
Species: Patulibacter medicamentivorans Cobalamin riboswitch
 RS: URS0000C5F271_1678637
MFE: -50.857
Ligand: cobalamin
Species: Streptomyces caatingaensis Cobalamin riboswitch
 RS: URS0000ABCA19_485913
MFE: -50.812
Ligand: SAM
Species: Ktedonobacter racemifer DSM 44963 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA028474 URS0000C03B3E_1097667 URS0000C5F271_1678637 URS0000ABCA19_485913
Length 141. 141. 141. 141.
Similarity - 0.963 0.961 0.961
Ensemble Norm 0.872 - - -
MFE -44.561 -67.111 -50.857 -50.812
Ligands - cobalamin cobalamin SAM
Gene DCTN4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15. 12.002 7.001
Length SE - 0. 0. 0.
Lev Distance - 42. 46. 49.
UBS 12. 10. 12. 11.
BS 0. 0. 0. 0.
ILL 5. 2. 5. 3.
ILR 3. 3. 5. 2.
H 4. 3. 2. 5.
BL 3. 4. 5. 3.
BR 2. 2. 2. 2.
UN 0.106 0.099 0.057 0.071

Sequences

Field Description
UTR seq + 25 gugggaaaccuaacgucaaagucuacguaggaagucguagggaaggcagcgaggaagacgcuggcucucgggucacgugaugcgccgggagcgucaucgccuccucccuccccaagATGCCATCGGCTGAAGCCAAACTAA
UTR dot + 25 ..((….))..((((……..)))).((..(((…((((.((.((.((((..(((….((((((((..((…..))..)))))))))))….)))))))).))))…))).))…(((….)))…….
RS 1 seq AGGGAAUCCGGUGCGAAUCCGGGACUGACGCGCAGCGGUGAGGACGGGGAUCGCGACCACGAGGCCACUGGUGCCGCCGGACCGCUCGUCCGCCGGCCUGGGAAGGCGGUCGCGAUCGAUCUCGUCCGAGUCCGAAGACCU
RS 1 dot …….(((.((((..((…….))..)))).)))…(((((((((((((((((…..(((.((((.((((.(((((…..))))).))))))))…)))))))))))))…)))))))..(((….)))..
RS 2 seq AGAGGAAGCCGGUGAGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCGCACCCCCGCGCACGAGCAGCACGCAACGCCACGGCCCGCGAAAGCCGGAAGGCAAGGGGGCCCGCGCCGAUCCGGGAGCCAGGAGACUC
RS 2 dot ……..((((…..((.((((((((.(((.((..((((.((((….(((….(((.((….((…..))…))..)))…)))….))))..)))).))))).))))))))))))))(((……..)))
RS 3 seq CUCUCAUCAAGAGAGGUGGAGGGACACGGCCCGACGAAGCCCGGCAACCCGCUUAACUUGUUUUGUAUUCAUGAGUAAUGAGGCAAGACGAGGGAGAAGGGUGCCAAUUCCGGCGGACUUUUUAUAGCCGCAAGAUGAGGG
RS 3 dot (((((…..)))))(((……)))(((……..))).(((.((((.(((..((((((((((..((((…..)))).)))))))))).)))..)))))))…((..((((.((……))))))..))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table