Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA028902 Similarity: 0.980 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA028902
Gene: DDX10
MFE: -24.228
ENS: 0.992
Length: 90.
Predicted Ligands:
TPP - 12/20
SAM - 4/20
glycine - 2/20
 RS: URS0000ABB0D4_888056
MFE: -25.542
Ligand: TPP
Species: Actinomyces sp. oral taxon 448 str. F0400 TPP riboswitch (THI element)
 RS: URS0000C1769C_1423804
MFE: -16.776
Ligand: SAM
Species: Lactobacillus similis DSM 23365 = JCM 2765 SMK box translational riboswitch (SAM-III)
 RS: URS0000C7F03D_883081
MFE: -24.285
Ligand: TPP
Species: Alloiococcus otitis ATCC 51267 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA028902 URS0000ABB0D4_888056 URS0000C1769C_1423804 URS0000C7F03D_883081
Length 90. 90. 90. 91.
Similarity - 0.980 0.980 0.979
Ensemble Norm 0.992 - - -
MFE -24.228 -25.542 -16.776 -24.285
Ligands - TPP SAM TPP
Gene DDX10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 4.004 7.
Length SE - 0. 0. 1.
Lev Distance - 26. 26. 24.
UBS 7. 8. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 3.
ILR 2. 2. 1. 2.
H 2. 2. 2. 2.
BL 2. 2. 1. 0.
BR 2. 3. 2. 1.
UN 0.067 0.122 0.133 0.077

Sequences

Field Description
UTR seq + 25 ccgugagucugaccuuaggugucucgugucugggguugauccgagcugucgccgccgccgccgcaATGGGCAAAACGGCCAACTCTCCGG
UTR dot + 25 ……(((.(((((((((………))))))))))))(((((..((.((((…..(((……)))….))))..)).))).))
RS 1 seq UCUACCGACACGGGGUGCCGCAAGGCUGAGAACACACCCGUCGAACCUGUUCGGACAAUGCUGACGAAGGGAUUGUCGCAUGCGCAGAUG
RS 1 dot …..((((..((((((((….)))…….)).)))))))…((((.((((((((.((……)).))))))…)).))))…
RS 2 seq UAAAGUUAUGAGUCUUCAUUCCCGAUAGGAUUCACUAGCUCUAGUGAAGAUGCCUUGUAACCGAAAAACGAAUUGGGGGAAUUUUUUAUG
RS 2 dot …((((((((((((((……))..))))))).)))))…..((((((.(((…..((((……..))))))).))))))….
RS 3 seq CCUUUUCACUAGGGGUAGUCAUUAGACUUGAGAAUGACCCUUUGAACCUGAUCGGGUUAAGACCCGCGGAGGGAAGUGAGUGGUUAGGUGG
RS 3 dot ….((((..((((((((((….))))……..))))))))))((((((((..(((…(((…..)))…))).))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table