Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA028929 Similarity: 0.973 Similarity: 0.971 Similarity: 0.970
UTR: 5HSAA028929
Gene: DDX18
MFE: -36.440
ENS: 0.938
Length: 124.
Predicted Ligands:
molybdenum - 6/20
guanidine - 5/20
cobalamin - 3/20
 RS: URS0000AB8716_767817
MFE: -38.125
Ligand: molybdenum
Species: Desulfotomaculum gibsoniae DSM 7213 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C815D0_1450761
MFE: -34.848
Ligand: glycine
Species: Aneurinibacillus sp. XH2 Glycine riboswitch
 RS: URS0000D97617_1797564
MFE: -50.190
Ligand: guanidine
Species: Burkholderiales bacterium RIFCSPLOWO2_02_FULL_67_64 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA028929 URS0000AB8716_767817 URS0000C815D0_1450761 URS0000D97617_1797564
Length 124. 122. 125. 122.
Similarity - 0.973 0.971 0.970
Ensemble Norm 0.938 - - -
MFE -36.440 -38.125 -34.848 -50.190
Ligands - molybdenum glycine guanidine
Gene DDX18 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 6.001 2.001
Length SE - 4. 1. 4.
Lev Distance - 31. 35. 35.
UBS 8. 8. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 3. 4. 2. 3.
H 3. 3. 3. 3.
BL 2. 3. 2. 3.
BR 0. 0. 2. 0.
UN 0.105 0.139 0.128 0.082

Sequences

Field Description
UTR seq + 25 gccgagcugcgcacgugcggccggaagggaaguaacgucagccugagaacugaguagcuguacuguguggcgccuuauucuaggcacuuguugggcagaATGTCACACCTGCCGATGAAACTCC
UTR dot + 25 …..((((((((.((((((((((..(((..(……)..)))…..)))….)))))))))))))))((((……))))..(((((.(((((……….))))))))))……
RS 1 seq AACCUAAUAGCUCUUCGAGUCGGGCAAACCUGCAAACAUAAUGUUAUGGUAACCCGACCGUUAGGGUUCGCCGGGAAACCGGCCUGCCUCCCAUUGCGGAAAGAAGAGAAACGUGUCGGGUU
RS 1 dot ……..((((((.((.((((((…(((.(((…….)))…)))..))))))))..)))))).(((((….)))))……(((..((((………….))))..)))..
RS 2 seq GGACGAAACUCUGGAGAGACCCCCUCCGCUUCCACACUAAUGAAACGGAGGAAAAAGGGCACCGAAGGAGCAAGUCUGCGCCACCGCGCAGAUAAUCUCUCAGGUAAAAGGACAGGGAUUACAAA
RS 2 dot ……..((((((…(.(((((((((.(((………))).))))))…..)))).))…))))….(((((((….)))))))((((((((…((……))))))))))….
RS 3 seq CUUGAAGACCGCUAGGGUUCCGGGCUCAGACCACUUCUCUCAAGAAGCCAUCUGAGCCGUCUGGUCCGAGAGCGGUCGGCCACGAUCGUGUGGCUCCACGGAGGGACAAAAGCCCGGGAGAC
RS 3 dot ……(((((((.(((..(((((((((((…(((((….)))))…))))))))…))))))…)))))))..(((((….)))))((((.(((.(………))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table