Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA028942 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA028942
Gene: DDX19A
MFE: -38.934
ENS: 0.883
Length: 96.
Predicted Ligands:
glycine - 12/20
TPP - 4/20
homocysteine - 2/20
 RS: URS0000DAD99B_1904970
MFE: -35.951
Ligand: Ni/Co
Species: Serinicoccus sp. CNJ-927 Glycine riboswitch
 RS: URS0000AB5580_500485
MFE: -19.759
Ligand: TPP
Species: Penicillium chrysogenum Wisconsin 54-1255 TPP riboswitch (THI element)
 RS: URS0000DA8E15_60175
MFE: -19.759
Ligand: TPP
Species: Penicillium nalgiovense TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA028942 URS0000DAD99B_1904970 URS0000AB5580_500485 URS0000DA8E15_60175
Length 96. 96. 97. 97.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.883 - - -
MFE -38.934 -35.951 -19.759 -19.759
Ligands - Ni/Co TPP TPP
Gene DDX19A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 3. 3.
Length SE - 0. 1. 1.
Lev Distance - 20. 20. 20.
UBS 8. 8. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 5. 3. 3.
ILR 2. 2. 2. 2.
H 1. 1. 1. 1.
BL 3. 2. 4. 4.
BR 1. 1. 2. 2.
UN 0.073 0.104 0.072 0.072

Sequences

Field Description
UTR seq + 25 cgagguuagggcccgcguugcgacguggugcagcgcauauuuucacaagugggucucccuuguccgggacuATGGCCACCGACTCGTGGGCCCTGG
UTR dot + 25 ……((((((((…..((((..(((((..((.((((.(((((((((.((….)))))))..)))).)))))))))))..)))))))))))).
RS 1 seq CGACGUCGCGUGGGAGAGUCCUCUCCGGCAUGCGGUGAGGCGCCGAAGGGGCAAACUCCCCAGCAAGCUCUCAGGCGCCAGGACCACGCGAAGCAG
RS 1 dot …..((((((((…..((((….(((..((..(((((.((.(..((((……))))..)..))))))).)))))))))))))))))…..
RS 2 seq CUGCAUGAAGACCGGUGUUCGACUCUUGUCGUUCUGAGAAUAUACGGUUAAACUUGAUCUGGGUAAUUCCAGCGAAAGGACUCAAUGCGCUUUUUCU
RS 2 dot ……(((((..(((((..((.((((.(((..(((.((((.((((((((….)))))…))))))))))))).)))).))…)))))))))).
RS 3 seq CUGCGUGAAGACCGGUGUUCGACUCUUGUCGUUCUGAGAAUAUACGGUUAAACUUGAUCUGGGUAAUUCCAGCGAAAGGACUCAAUGCGCUUUUUCU
RS 3 dot ……(((((..(((((..((.((((.(((..(((.((((.((((((((….)))))…))))))))))))).)))).))…)))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table