Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029028 Similarity: 0.958 Similarity: 0.955 Similarity: 0.955
UTR: 5HSAA029028
Gene: DDX24
MFE: -60.459
ENS: 0.780
Length: 157.
Predicted Ligands:
TPP - 6/20
cobalamin - 5/20
FMN - 5/20
 RS: URS0002329963_657323
MFE: -34.803
Ligand: cobalamin
Species: Ruminococcus sp. SR1/5 Cobalamin riboswitch
 RS: URS000231CD2B_1636152
MFE: -71.019
Ligand: SAM
Species: Planctomyces sp. SH-PL62 SAM riboswitch (S box leader)
 RS: URS0000C122CD_42256
MFE: -65.284
Ligand: FMN
Species: Rubrobacter radiotolerans FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029028 URS0002329963_657323 URS000231CD2B_1636152 URS0000C122CD_42256
Length 157. 156. 158. 157.
Similarity - 0.958 0.955 0.955
Ensemble Norm 0.780 - - -
MFE -60.459 -34.803 -71.019 -65.284
Ligands - cobalamin SAM FMN
Gene DDX24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.003 6.002 10.
Length SE - 1. 1. 0.
Lev Distance - 51. 56. 55.
UBS 13. 13. 13. 13.
BS 0. 0. 0. 0.
ILL 4. 3. 2. 4.
ILR 2. 2. 2. 4.
H 3. 2. 3. 2.
BL 5. 7. 4. 6.
BR 7. 7. 6. 5.
UN 0.102 0.154 0.152 0.096

Sequences

Field Description
UTR seq + 25 agcgcgcacgaguacgugcguggaggucccgccccggaacugcaguugcugcugcagcugagguacagcggcgguuucugagguucuucacucgcgacugacggagcugcgguggcgucuccacacgcaaccATGAAGTTGAAGGACACAAAATCAA
UTR dot + 25 ..((((((((….)))))))).(((..(((((.(.(.(((.(((((((….))))))).))).).).)))))..)))…((((((((……(((..((..(.((((((((…..)))).)))).)..)).)))))))))))……….
RS 1 seq AACAAAAAAAUCGAGCGUGGUUCGGCUGAUGGCAGCCGAUUUAAGGAAAUCCGGUGCGAUUCCGGAGCUGCUUUUCCCUGUGUGAAAUGUAUCGAAUGAAAAACGCCUUAUGAAAACAUUUUGAGCCAGUAUAUCCAACACGUCAGGCAAAGAAUA
RS 1 dot …………(((((.(.(((((..(((.(((.(.(((((….))))).).))).)))))))).))))))…((((((((..((((((.(..(.((((…………….)))).)..).))))))….)))).))))………
RS 2 seq AUCUUAUCCAGAGUGGCUGAGGGAAGGGCCCUAUGACGCCACAGCAACCGGUCCACCGUUUUGGUGGACGCUGGUGCUAACUCCUGCCGAGCGCCCGUUCGGGCGAGACCGGGGAAAUCCCCCGGAUCGCCGAUCGCGGUUCAUCGGACAGAUAAGAU
RS 2 dot …………(((((..((((…..))))…..)))))(((.(((((((((((…..)))))))..)))))))…..((((((((.(((((.((.(((((..((((((…..)))))).))))))).)).))).).)))).)))…….
RS 3 seq GUCGACUUUCGGGGGCGGGUGGAAUUCCCGCACCGGCGGUGAGCCCGACGGGGGCCGUUCCCCCGCUGGAGAGUCCGCGAACCCCAGCCCGAGGGCCGGGGCCGAGCCGGUGAGAUUCCGGCACCGACGGUAAAAGUCCGGAUGGGAGAAAGGAAAC
RS 3 dot ((.(((((((…((((((.(((((.(((.(..((((…..))).)..).)))..))))))))))).))))))).))….((((.((…((((….((((.(((((…….)))))…..))))….)))))).))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table