Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029035 Similarity: 0.956 Similarity: 0.956 Similarity: 0.954
UTR: 5HSAA029035
Gene: DDX24_0
MFE: -49.645
ENS: 0.799
Length: 141.
Predicted Ligands:
cobalamin - 9/20
molybdenum - 5/20
TPP - 4/20
 RS: URS0000C41CD1_1239307
MFE: -47.483
Ligand: molybdenum
Species: Sodalis praecaptivus Moco (molybdenum cofactor) riboswitch
 RS: URS0000D8784D_1834189
MFE: -24.718
Ligand: cobalamin
Species: Enterococcus sp. 7F3_DIV0205 AdoCbl riboswitch
 RS: URS0000D8B26B_263852
MFE: -27.777
Ligand: cobalamin
Species: Pilibacter termitis AdoCbl riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029035 URS0000C41CD1_1239307 URS0000D8784D_1834189 URS0000D8B26B_263852
Length 141. 142. 143. 141.
Similarity - 0.956 0.956 0.954
Ensemble Norm 0.799 - - -
MFE -49.645 -47.483 -24.718 -27.777
Ligands - molybdenum cobalamin cobalamin
Gene DDX24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 8. 8.004
Length SE - 1. 4. 0.
Lev Distance - 57. 52. 59.
UBS 5. 5. 6. 6.
BS 5. 6. 3. 3.
ILL 1. 2. 2. 2.
ILR 1. 1. 2. 1.
H 3. 3. 3. 4.
BL 3. 2. 2. 3.
BR 3. 3. 3. 4.
UN 0.177 0.183 0.175 0.113

Sequences

Field Description
UTR seq + 25 guggaggucccgccccggaacugcaguugcugcugcagcugagguacagcggcgguuucugagguucuucacucgcgacugacggagcugcgguggcgucuccacacgauggacagATGAAGTTGAAGGACACAAAATCAA
UTR dot + 25 (((((((..(((((.(((..((((((((((.(((((.((((…..)))).)))))….(((……..)))))))))).)))..))).)))))..)))))))…………(((..(((…….)))..))).
RS 1 seq AAGGCAACAUAACUCCUAGCCUUUACGCCUAAGUGGCUCCCGAUGAGCCAUACGGGGUUCUGGCCGUGGCGAUGGCCACCAGGGUGCAGGGUAGAAAUGCCGGCAUCUCCCGUAUUUGGAAAGGUGUUACUGUGUCACAACU
RS 1 dot ..(((.(((((((.(((..((..(((((((..(((((((…..)))))))..)))….(((((((….)))))))…((((((..((((….)))).))))))..))))…))..))).)))).))))))……
RS 2 seq AAUUGAAUAUGUAUUGAUUUAGAUGGAAAUUUGGUUAGAUUCCAAUACGGUCCCGCCACUGUAACGAGCAGCAAUGCUAUAAGUCAGGUCUUUCUAUUUUAGUACCCCGUACUAUUGUUUCGAGGCAAAGCAAUAGGGCACAU
RS 2 dot ……….(((((((..((((.(((….((((..((((…….))))..))))(((…..((((….))))……))).))).))))..)))))))…((.(((((((((…….))))))))).))….
RS 3 seq AAAACAUAAUGAGAGUGAAUGUACAAUGGAAUGAGGUGGAAAUCCUCAACGGUCCGUUAUCCACAGUAAAUAGCACAUCGCUAAAGUCUGGUCUUUUGUCCAUUCACUAAGUACAUAGGAAGAUACGCGGUUCCUUUGCUU
RS 3 dot ………….((((((((.((((.(((.(((((…….)))))..((……..)).(((….((((…..))))….))).))).)))).))))))))(((((…(((((………))))).)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table