Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029046 Similarity: 0.994 Similarity: 0.994 Similarity: 0.992
UTR: 5HSAA029046
Gene: DDX27
MFE: -5.801
ENS: 0.987
Length: 34.
Predicted Ligands:
preQ_1 - 8/20
SAM - 7/20
unknown - 2/20
RS: URS000080E037_32630
MFE: -4.622
Ligand: preQ_1
Species: PreQ1 riboswitch from None (PDB 3K1V, chain A)
RS: URS000080E020_32630
MFE: -4.622
Ligand: preQ_1
Species: PreQ1 riboswitch from None (PDB 3FU2, chain A)
RS: URS000080E32E_119072
MFE: -6.098
Ligand: preQ_1
Species: PREQ1 RIBOSWITCH from Caldanaerobacter subterraneus subsp. tengcongensis (PDB 6VUH, chain A)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029046 URS000080E037_32630 URS000080E020_32630 URS000080E32E_119072
Length 34. 34. 34. 33.
Similarity - 0.994 0.994 0.992
Ensemble Norm 0.987 - - -
MFE -5.801 -4.622 -4.622 -6.098
Ligands - preQ_1 preQ_1 preQ_1
Gene DDX27 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 2.003 2.
Length SE - 0. 0. 1.
Lev Distance - 8. 8. 9.
UBS 2. 1. 1. 1.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 1. 1. 1. 1.
BL 1. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.412 0.353 0.353 0.394

Sequences

Field Description
UTR seq + 25 aagugacgcATGGTACTTGCGCAAAGACGACGAG
UTR dot + 25 …((.((((…….))))))………..
RS 1 seq AGAGGUUCUAGCACAUCCCUCUAUAAAAAACUAA
RS 1 dot (((((…………)))))…………
RS 2 seq AGAGGUUCUAGCUACACCCUCUAUAAAAAACUAA
RS 2 dot (((((…………)))))…………
RS 3 seq CUGGGUCGCAGUAACCCCAGUUAACAAAACAAG
RS 3 dot (((((……….)))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table