Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029048 Similarity: 0.983 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA029048
Gene: DDX27_0
MFE: -21.548
ENS: 0.973
Length: 86.
Predicted Ligands:
zmp-ztp - 18/20
GMP - 1/20
Mg2+ - 1/20
RS: URS0000C59163_947969
MFE: -31.424
Ligand: zmp-ztp
Species: Cellulomonas sp. T26 ZMP/ZTP riboswitch
RS: URS0002322A18_1077972
MFE: -28.134
Ligand: zmp-ztp
Species: Arthrobacter globiformis NBRC 12137 ZMP/ZTP riboswitch
RS: URS0000C5B64B_319795
MFE: -29.062
Ligand: zmp-ztp
Species: Deinococcus geothermalis DSM 11300 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029048 URS0000C59163_947969 URS0002322A18_1077972 URS0000C5B64B_319795
Length 86. 87. 87. 85.
Similarity - 0.983 0.980 0.980
Ensemble Norm 0.973 - - -
MFE -21.548 -31.424 -28.134 -29.062
Ligands - zmp-ztp zmp-ztp zmp-ztp
Gene DDX27 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 18. 6.001
Length SE - 1. 1. 1.
Lev Distance - 20. 19. 24.
UBS 8. 9. 8. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 1.
ILR 3. 3. 2. 2.
H 2. 2. 2. 3.
BL 0. 2. 4. 1.
BR 3. 4. 3. 2.
UN 0.047 0.057 0.057 0.071

Sequences

Field Description
UTR seq + 25 augcgcacucuuaagaggucgaacggggagggcggcaggggcucuggaacggaagugacgcATGGTACTTGCGCAAAGACGACGAG
UTR dot + 25 (((((((((((..((((((((..(…..)..))))…..))))…..))).))).)))))….((((((……)).))))
RS 1 seq UGUCCGGGUCGCGACUGGCGAACAGGUGGGUCACCACCAGGGAGCGGCAGCACAGCAGACUUCGGGUCGUACGCCUGGGCCGCGGGU
RS 1 dot .(((((((((((..(((.((..(.(((((….)))))…)..)).)))….)).)))).)))).)….(((((…..)))))
RS 2 seq UUGUGGCGUCGCAACUGGCGUUUGGGUGGCUAACCACCAGGGAGCGGCAUUCACGAAGACCACGGAUCGUACGCCUGGGCCGAGGGU
RS 2 dot (((((((.(((….((.(((((.(((((….)))))…))))).))….))).).))))))…..((.(((……)))))
RS 3 seq AGAGCGGGUGGUGACUGGCGCUGAACGUGGGCCAACCACGGGGAAGCCAUCCGCAUUGCUGUGAUCGCGCGCCUGGGUCGGACGC
RS 3 dot …(((((((((..(((((.(…….).))))……..)..)))))))))…((…….))(((((……)).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table