Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029108 Similarity: 0.981 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA029108
Gene: DDX41
MFE: -26.291
ENS: 0.975
Length: 94.
Predicted Ligands:
TPP - 8/20
SAM - 5/20
tetrahydrofolate - 3/20
 RS: URS0000DAB9A9_263852
MFE: -23.989
Ligand: tetrahydrofolate
Species: Pilibacter termitis THF riboswitch
 RS: URS0000AB5C20_748224
MFE: -26.989
Ligand: tetrahydrofolate
Species: Faecalibacterium cf. prausnitzii KLE1255 THF riboswitch
 RS: URS0000AB3403_12908
MFE: -26.989
Ligand: tetrahydrofolate
Species: unclassified sequences THF riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029108 URS0000DAB9A9_263852 URS0000AB5C20_748224 URS0000AB3403_12908
Length 94. 94. 96. 96.
Similarity - 0.981 0.981 0.981
Ensemble Norm 0.975 - - -
MFE -26.291 -23.989 -26.989 -26.989
Ligands - tetrahydrofolate tetrahydrofolate tetrahydrofolate
Gene DDX41 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.007 5.003 5.003
Length SE - 0. 4. 4.
Lev Distance - 22. 19. 19.
UBS 6. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 2. 3. 2. 2.
H 2. 3. 2. 2.
BL 1. 3. 3. 3.
BR 2. 1. 2. 2.
UN 0.223 0.138 0.167 0.167

Sequences

Field Description
UTR seq + 25 cacaucggauugggucucacgcaaggaugaggcgggguuucgccguggcgcgcaugcgugcagcaaagaATGGAGGAGTCGGAACCCGAACGGA
UTR dot + 25 ………….(((((((…..).)))))).((((((((((((.((((((….)))).))…..))))……))))))))…….
RS 1 seq AACAGAGUAGAAGGUGCUGCGUUAAGUGUCGCAAGGAUGGGAUGUUGCCUGCGAACGAAAGCGUAAGCUGCGGUAGCCCUUCGCAUUCGCUGAU
RS 1 dot ……(((…..)))((((……..)))).(((((.((.((((((.((..(((….)))..))…))))))…)).)))))……
RS 2 seq AACAGAGUAAGACCAUGUGCGUUAAGUGCCGCAUCAACGGGGAGUUGUGCUGUGGACGAAGGUGUACCCGCGGUGCAUGGUCUGCAUCCCGCUGCU
RS 2 dot …………..(((((.((…..)))))))((.(((((.(((((((((((((((….)))..))))))))))……)).))))).))..
RS 3 seq AACAGAGUAAGGCCAUGUGCGUUAAGUGCCGCAUCAACGGGGAGUUGUGCUGUGGACGAAGGUGUACCCGCGGUGCAUGGUCUGCAUCCCGCUGCU
RS 3 dot …………..(((((.((…..)))))))((.(((((.(((((((((((((((….)))..))))))))))……)).))))).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table