Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029136-0 Similarity: 0.987 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA029136-0
Gene: DDX47
MFE: -7.776
ENS: 0.870
Length: 47.
Predicted Ligands:
SAM - 9/20
glutamine - 8/20
preQ_1 - 2/20
 RS: URS00021EDDEE_1912092
MFE: -11.046
Ligand: SAM
Species: Nioella sediminis SAM-SAH-Weickhmann-2018 RNA
 RS: URS0000C7168F_12908
MFE: -6.675
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C1E216_12908
MFE: -7.522
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029136-0 URS00021EDDEE_1912092 URS0000C7168F_12908 URS0000C1E216_12908
Length 47. 47. 48. 47.
Similarity - 0.987 0.986 0.986
Ensemble Norm 0.870 - - -
MFE -7.776 -11.046 -6.675 -7.522
Ligands - SAM glutamine glutamine
Gene DDX47 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.037 7.017 10.004
Length SE - 0. 1. 0.
Lev Distance - 15. 16. 16.
UBS 6. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 0. 1. 0.
H 1. 1. 1. 2.
BL 3. 2. 3. 2.
BR 4. 3. 2. 2.
UN 0.213 0.404 0.083 0.277

Sequences

Field Description
UTR seq + 25 acuuccggagaccucacacaagATGGCGGCACCCGAGGAACACGATT
UTR dot + 25 .((((.((.(.((((((….).))).))).)).))))………
RS 1 seq CCCCACAACGGCUUCCUGGCGUGGUGGCGAUAACAGGUAACGGAGCA
RS 1 dot .(((((.(((.(…..).))).)))).)………………
RS 2 seq AUCGUUUGGCUCAUUGAGUUGGAAGUAAGGUAACUGAAGAAACGCACU
RS 2 dot …((.((..((.((.(((((………))))).))))..)).)).
RS 3 seq UACGUUCAUCCAAUGGGACGGAAGUAGGGAAACCGAAGGAACGCACU
RS 3 dot (((.(((.(((….))).))).)))((….))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table